v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Triops cancriformis tcf-miR-993-3p URS00003BF529_194544

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAGCUCGUCUCUACAGGUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Acyrthosiphon pisum api-miR-993
  2. Apis mellifera (honey bee) ame-miR-993-3p
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-993
  4. Blattella germanica Bge-Mir-10-P4_3p (mature (guide))
  5. Bombyx mori (domestic silkworm) bmo-miR-993a-3p
  6. Cochliomyia hominivorax mature cho-miR-993-3p
  7. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-993-3p
  8. Drosophila ananassae Dan-Mir-10-P4_3p (mature (guide))
  9. Drosophila melanogaster (fruit fly) dme-miR-993-3p
  10. Drosophila mojavensis Dmo-Mir-10-P4_3p (mature (guide))
  11. Drosophila pseudoobscura dps-miR-993-3p
  12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331076_df_nrg
  13. Drosophila simulans dsi-miR-993-3p
  14. Drosophila virilis dvi-miR-993-3p
  15. Drosophila yakuba Dya-Mir-10-P4_3p (mature (guide))
  16. Glossina pallidipes (tsetse fly) Gpa-Mir-10-P4_3p (mature (guide))
  17. Heliconius melpomene (postman butterfly) hme-miR-993
  18. Nasonia giraulti ngi-miR-993
  19. Nasonia longicornis nlo-miR-993
  20. Nasonia vitripennis nvi-miR-993
  21. Parasteatoda tepidariorum (common house spider) pte-miR-993b-3p
  22. Tribolium castaneum (red flour beetle) tca-miR-993-3p
 Relationships

Molecular Relationships