v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30d URS00003B981C_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUAAACAUCCCCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callorhinchus milii eshark_mir-30_5
  2. Chrysemys picta cpi-miR-30d-5p
  3. Cyprinus carpio ccr-miR-30d
  4. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-242
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72687
  6. Ornithorhynchus anatinus oan-miR-30d-5p
  7. Oryzias latipes ola-miR-30d-5p
  8. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63159
  9. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3247382