Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-242 URS00003B981C_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30d
  2. Callorhinchus milii eshark_mir-30_5
  3. Chrysemys picta cpi-miR-30d-5p
  4. Cyprinus carpio ccr-miR-30d
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72687
  6. Ornithorhynchus anatinus oan-miR-30d-5p
  7. Oryzias latipes ola-miR-30d-5p
  8. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63159
  9. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3247382