Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sciurus vulgaris (Eurasian red squirrel) microRNA 204 (ENSSVLG00005021758.1) secondary structure diagram

Sciurus vulgaris (Eurasian red squirrel) microRNA 204 (ENSSVLG00005021758.1) URS000039AE8A_55149

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Ailuropoda melanoleuca microRNA 204 (ENSAMEG00000022692.2)
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000003167.1)
  3. Balaenoptera musculus microRNA 204 (ENSBMSG00010002918.1)
  4. Callithrix jacchus miRNA (ENSCJAG00000024032.3)
  5. Camelus dromedarius microRNA 204 (ENSCDRG00005001797.1)
  6. Carlito syrichta miRNA (ENSTSYG00000022736.2)
  7. Castor canadensis miRNA (ENSCCNG00000018566.1)
  8. Cebus imitator microRNA 204 (ENSCCAG00000005265.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000002663.1)
  10. Delphinapterus leucas microRNA 204 (ENSDLEG00000009637.1)
  11. Equus asinus asinus microRNA 204 (ENSEASG00005009596.1)
  12. Equus asinus microRNA 204 (ENSEASG00005009596.2)
  13. Equus caballus (horse) miRNA (ENSECAG00000028185.1, ENSECAG00000030779.1)
  14. Felis catus microRNA 204 (ENSFCAG00000022005.3)
  15. Gorilla gorilla gorilla ggo-mir-204 (ENSGGOG00000030597.2)
  16. Gorilla gorilla (western gorilla) microRNA ggo-mir-204 precursor
  17. Homo sapiens (human) microRNA hsa-mir-204 precursor
  18. Lynx canadensis (Canada lynx) microRNA 204 (ENSLCNG00005018584.1)
  19. Macaca mulatta microRNA mml-mir-204 precursor
  20. Macaca nemestrina microRNA mne-mir-204 precursor
  21. Mandrillus leucophaeus miRNA (ENSMLEG00000012338.1)
  22. Marmota marmota marmota microRNA 204 (ENSMMMG00000011680.1)
  23. Monodon monoceros microRNA 204 (ENSMMNG00015014225.1)
  24. Myotis lucifugus (little brown bat) microRNA 204 (ENSMLUG00000018067.1)
  25. Neogale vison microRNA 204 (ENSNVIG00000011215.1)
  26. Otolemur garnettii miRNA (ENSOGAG00000020361.1)
  27. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-204 precursor
  28. Panthera leo microRNA 204 (ENSPLOG00000012602.1)
  29. Panthera pardus (leopard) microRNA 204 (ENSPPRG00000014729.1)
  30. Panthera tigris altaica (Tiger) microRNA 204 (ENSPTIG00000001353.1)
  31. Pan troglodytes microRNA ptr-mir-204 precursor
  32. Papio anubis miRNA (ENSPANG00000002477.3)
  33. Phocoena sinus microRNA 204 (ENSPSNG00000013012.1)
  34. Physeter catodon (sperm whale) microRNA 204 (ENSPCTG00005003483.1)
  35. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000039370.1)
  36. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021764.2)
  37. Pongo pygmaeus microRNA ppy-mir-204 precursor
  38. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000025833.1)
  39. Propithecus coquereli miRNA (ENSPCOG00000009627.1)
  40. Pteropus vampyrus (large flying fox) microRNA 204 (ENSPVAG00000025825.1)
  41. Rhinolophus ferrumequinum microRNA 204 (ENSRFEG00010009038.1)
  42. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007978.1)
  43. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000010056.1)
  44. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-204 precursor
  45. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000015965.1)
  46. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000007206.1)
  47. Suricata suricatta microRNA 204 (ENSSSUG00005015638.1)
  48. Theropithecus gelada microRNA 204 (ENSTGEG00000025479.1)
  49. Tupaia belangeri microRNA 204 (ENSTBEG00000017860.1)
  50. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010023509.1)
  51. Ursus americanus microRNA 204 (ENSUAMG00000018544.1)
  52. Ursus maritimus (Polar bear) microRNA 204 (ENSUMAG00000021930.1)
  53. Ursus thibetanus thibetanus microRNA 204 (ENSUTTG00000008324.1)
  54. Zalophus californianus miRNA (ENSZCAG00015014798.1)
2D structure Publications