Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) Tgu-Mir-23-P3_3p (mature (guide)) URS0000391DB6_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Alligator mississippiensis ami-miR-23a-3p
  2. Bos taurus bta-miR-23a
  3. Callithrix jacchus cja-miR-23a
  4. Danio rerio (zebrafish) dre-miR-23a-3p
  5. Gadus morhua gmo-miR-23a-3p
  6. Haplochromis burtoni abu-miR-23a
  7. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-23a
  8. Homo sapiens (human) Hsa-Mir-23-P1_3p (mature (guide))
  9. Latimeria chalumnae Lch-Mir-23-P1_3p (mature (guide))
  10. Maylandia zebra (zebra mbuna) mze-miR-23a
  11. Microcaecilia unicolor Mun-Mir-23-P3f_3p (mature (guide))
  12. Monopterus albus Mal-Mir-23-P1_3p (mature (guide))
  13. Mus musculus Mus_musculus piRNA piR-mmu-72415
  14. Neolamprologus brichardi (lyretail cichlid) nbr-miR-23a
  15. Ophiophagus hannah oha-miR-23a-3p
  16. Oreochromis niloticus (Nile tilapia) oni-miR-23a
  17. Ornithorhynchus anatinus (platypus) oan-miR-23a-3p
  18. Oryzias latipes (Japanese medaka) ola-miR-23a
  19. Otolemur garnettii oga-miR-23a
  20. Ovis aries oar-miR-23a
  21. Pteropus alecto pal-miR-23a-3p
  22. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62943
  23. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-23-P3_3p (mature (guide))
  24. Takifugu rubripes (torafugu) fru-miR-23a
  25. Tetraodon nigroviridis tni-miR-23a
  26. Tor tambroides miR-23a-3p
  27. Xenopus laevis (African clawed frog) xla-miR-23a-3p