Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-23a URS0000391DB6_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-23a: Bta-mir-23a, a microRNA, has been found to play a role in various biological processes, including the direct targeting of Zfp423 [PMC9931865]. Studies have shown that bta-mir-23a is down-regulated in certain situations, such as in CY compared to CL and YK [PMC6949159]. Downregulation of bta-mir-23a has also been associated with impaired sperm division [PMC9941329]. Bta-mir-23a has been shown to inhibit the key adipogenic transcription factors PPARγ and C/EBPα, leading to decreased fat aggregation [PMC7140828]. It has also been found to suppress certain target genes involved in various biological processes [PMC8928958]. The expression of bta-mir-23a has been detected in different tissues and was found to have ubiquitous expression patterns [PMC7588927]. Furthermore, studies have demonstrated that bta-mir-23a can enhance the differentiation of myogenic cells by targeting MDFIC [PMC7588927]. It has also been associated with muscle contraction and growth factor activity [PMC7588927]. Overall, the research suggests that bta-mir-23a plays a role in various biological processes and may have potential applications for preventing muscle atrophy and promoting myogenesis [PMC7588927].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Alligator mississippiensis ami-miR-23a-3p
  2. Callithrix jacchus cja-miR-23a
  3. Danio rerio (zebrafish) dre-miR-23a-3p
  4. Gadus morhua gmo-miR-23a-3p
  5. Haplochromis burtoni abu-miR-23a
  6. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-23a
  7. Homo sapiens (human) Hsa-Mir-23-P1_3p (mature (guide))
  8. Latimeria chalumnae Lch-Mir-23-P1_3p (mature (guide))
  9. Maylandia zebra (zebra mbuna) mze-miR-23a
  10. Microcaecilia unicolor Mun-Mir-23-P3f_3p (mature (guide))
  11. Monopterus albus Mal-Mir-23-P1_3p (mature (guide))
  12. Mus musculus Mus_musculus piRNA piR-mmu-72415
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-23a
  14. Ophiophagus hannah oha-miR-23a-3p
  15. Oreochromis niloticus (Nile tilapia) oni-miR-23a
  16. Ornithorhynchus anatinus (platypus) oan-miR-23a-3p
  17. Oryzias latipes (Japanese medaka) ola-miR-23a
  18. Otolemur garnettii oga-miR-23a
  19. Ovis aries oar-miR-23a
  20. Pteropus alecto pal-miR-23a-3p
  21. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62943
  22. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-23-P3_3p (mature (guide))
  23. Taeniopygia guttata Tgu-Mir-23-P3_3p (mature (guide))
  24. Takifugu rubripes (torafugu) fru-miR-23a
  25. Tetraodon nigroviridis tni-miR-23a
  26. Tor tambroides miR-23a-3p
  27. Xenopus laevis (African clawed frog) xla-miR-23a-3p
Publications