Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-106b-3p URS0000384021_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-106b: Mmu-mir-106b is a microRNA that has been found to be differentially expressed in plasma and aorta tissue samples [PMC4346489]. It is part of the miR-106b~25 cluster and is located in the 13th intron of the MCM7 gene [PMC7803573]. In a study comparing atherosclerotic tissue with control tissue, mmu-mir-106b was found to be downregulated [PMC4346489]. Additionally, in another study, mmu-mir-106b was downregulated in DIO mice [PMC4571067]. The regulation of mmu-mir-106b may occur at the transcriptional level through activation of the ER stress effector pathway PERK [PMC7803573]. Computational prediction suggests that mmu-mir-106b may have more unpaired bases than other miRNAs, indicating that Dicer can tolerate loosely paired structures [PMC5716067]. Mmu-mir-106b has been found to be regulated by transcription factors Esrrb and Oct4, Sox2, Nanog, and Esrrb (OSNE) [PMC9149258]. It has also been shown that mmu-mir-106b can regulate more than 10 target genes [PMC9149258]. In an experimental study using AAV9 vectors, mmu-mir-106b precursor miRNA was expressed in neonatal mice through intraperitoneal injection [PMC8355162]. References: [PMC4346489] [PMC4571067] [PMC7803573] [PMC5716067] [PMC9149258] [PM8355162]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCACUGUGGGUACUUGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Publications