Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tor tambroides (Thai mahseer) miR-144-3p URS000037C5A8_329116

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUAUAGAUGAUGUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Anolis carolinensis (green anole) aca-miR-144-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-144
  3. Danio rerio (zebrafish) dre-miR-144-3p
  4. Equus caballus (horse) eca-miR-144
  5. Homo sapiens (human) hsa-miR-144-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-144
  7. Mus musculus mmu-miR-144-3p
  8. Notamacropus eugenii (tammar wallaby) Neu-Mir-144-v2_3p* (star (passenger))
  9. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
  10. Python bivittatus (Burmese python) pbv-miR-144-3p
  11. Rattus norvegicus (Norway rat) rno-miR-144-3p
  12. Taeniopygia guttata (zebra finch) tgu-miR-144-3p
  13. Takifugu rubripes fru-miR-144
  14. Tetraodon nigroviridis tni-miR-144
Relationships

Molecular Relationships