Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-144-3p URS000037C5A8_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUAUAGAUGAUGUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Anolis carolinensis aca-miR-144-3p
  2. Artibeus jamaicensis aja-miR-144
  3. Danio rerio (zebrafish) dre-miR-144-3p
  4. Equus caballus (horse) eca-miR-144
  5. Homo sapiens (human) hsa-miR-144-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-144
  7. Mus musculus (house mouse) mmu-miR-144-3p
  8. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
  9. Python bivittatus pbv-miR-144-3p
  10. Taeniopygia guttata tgu-miR-144-3p
  11. Takifugu rubripes fru-miR-144
  12. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-144
  13. Tor tambroides (Thai mahseer) miR-144-3p
Publications