Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Glutamine-TTG 1-3 (Dmel_CR31070, Dmel_CR31071, Dmel_CR32093) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Glutamine-TTG 1-3 (Dmel_CR31070, Dmel_CR31071, Dmel_CR32093) URS0000368249_7227

mRNA interactions total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCUAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUAGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 335 other species

  1. Acanthisitta chloris tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acrocephalus arundinaceus (great reed warbler) tRNA
  4. Aegotheles bennettii tRNA
  5. Albula glossodonta (roundjaw bonefish) tRNA
  6. Albula goreensis tRNA
  7. Alca torda tRNA
  8. Ceyx cyanopectus Alcedo cyanopecta tRNA
  9. Alectura lathami (australian brush-turkey) tRNA
  10. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  11. Alligator sinensis (Chinese alligator) tRNA
  12. Alosa alosa (allis shad) tRNA-Gln
  13. Amazona aestiva tRNA
  14. Amazona collaria (yellow-billed parrot) tRNA
  15. Amazona guildingii tRNA
  16. Anabarilius grahami tRNA
  17. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  18. Anas platyrhynchos tRNA
  19. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon UUG)
  20. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon UUG)
  21. Anas zonorhyncha tRNA
  22. Anguilla anguilla tRNA
  23. Anhinga anhinga tRNA
  24. Anhinga rufa (African darter) tRNA
  25. Anniella stebbinsi tRNA-Gln
  26. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  27. Anseranas semipalmata (magpie goose) tRNA
  28. Anser brachyrhynchus (pink-footed goose) tRNA
  29. Anser cygnoides (Chinese goose) tRNA
  30. Aphidius gifuensis (Parasitoid wasp) tRNA-Gln
  31. Aptenodytes forsteri (emperor penguin) tRNA
  32. Aptenodytes patagonicus (king penguin) tRNA
  33. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  34. Apteryx owenii (little spotted kiwi) tRNA
  35. Aquila chrysaetos chrysaetos tRNA
  36. Aramus guarauna (limpkin) tRNA
  37. Arctogadus glacialis (Arctic cod) tRNA-Gln
  38. Ardeotis kori tRNA
  39. Arenaria interpres (ruddy turnstone) tRNA
  40. Asarcornis scutulata tRNA
  41. Astyanax mexicanus (Mexican tetra) tRNA
  42. Atlantisia rogersi (inaccessible island rail) tRNA
  43. Aythya fuligula (tufted duck) tRNA
  44. Bacteroidota bacterium tRNA-Gln
  45. Bactrocera dorsalis (Oriental fruit fly) transfer RNA glutamine (anticodon UUG)
  46. Bactrocera latifrons tRNA-Gln
  47. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon UUG)
  48. Bactrocera oleae (Olive fruit fly) tRNA-Gln
  49. Bactrocera tryoni (Queensland fruitfly) tRNA-Gln
  50. Balaeniceps rex (shoebill) tRNA
  51. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  52. Baryphthengus martii tRNA
  53. Belgica antarctica tRNA-Gln for anticodon UUG
  54. Biomphalaria glabrata tRNA
  55. Biomphalaria pfeifferi tRNA-Gln
  56. Bison bison bison (north american plains bison) tRNA
  57. Boreogadus saida tRNA-Gln
  58. Bos grunniens (domestic yak) tRNA
  59. Bos mutus Bos grunniens mutus tRNA
  60. Bos indicus tRNA
  61. Bos indicus x Bos taurus (hybrid cattle) tRNA
  62. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  63. Bradysia coprophila (Black fungus gnats) tRNA-Gln
  64. Pseudolycoriella hygida Bradysia hygida tRNA
  65. Branchiostoma floridae (Florida lancelet) tRNA
  66. Bugula neritina tRNA
  67. Burhinus bistriatus tRNA
  68. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  69. Callipepla squamata (scaled quail) tRNA
  70. Calonectris borealis (cory's shearwater) tRNA
  71. Calypte anna (Anna's hummingbird) tRNA
  72. Capra hircus (goat) tRNA
  73. Antrostomus carolinensis tRNA
  74. Carassius auratus (goldfish) tRNA
  75. Cariama cristata (red-legged seriema) tRNA
  76. Cathartes aura (turkey vulture) tRNA
  77. Centropus unirufus tRNA
  78. Cepphus grylle tRNA
  79. Ceratitis capitata tRNA-Gln
  80. Cervus elaphus hippelaphus tRNA
  81. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  82. Chaetura pelagica (chimney swift) tRNA
  83. Chanos chanos (milkfish) tRNA
  84. Charadrius vociferus tRNA
  85. Chelonia mydas (green seaturtle) tRNA
  86. Chelydra serpentina (snapping turtle) tRNA
  87. Chionis minor (black-faced sheathbill) tRNA
  88. Chloroceryle aenea tRNA
  89. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  90. Chrysolophus pictus (golden pheasant) tRNA
  91. Chrysoperla carnea (Green lacewing) tRNA-Gln
  92. Chunga burmeisteri (black-legged seriema) tRNA
  93. Ciconia maguari tRNA
  94. Circaetus pectoralis tRNA
  95. Clunio marinus tRNA
  96. Clupea harengus (Atlantic herring) tRNA
  97. Clytia hemisphaerica tRNA-Gln for anticodon UUG
  98. Cochlearius cochlearius tRNA
  99. Colinus virginianus (northern bobwhite) tRNA
  100. Columba livia tRNA
  101. Columbina picui (picui ground-dove) tRNA
  102. Conger conger tRNA
  103. Coregonus sp. 'balchen' tRNA
  104. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015298.1
  105. Corythaixoides concolor (grey go-away-bird) tRNA
  106. Coturnix japonica (Japanese quail) tRNA
  107. Crocodylus porosus (Australian saltwater crocodile) tRNA
  108. Crotophaga sulcirostris (groove-billed ani) tRNA
  109. Cuculus canorus (common cuckoo) tRNA
  110. Cyanobacteria bacterium J06582_2 tRNA-Gln
  111. Cyprinus carpio carpio tRNA
  112. Cyprinus carpio (common carp) tRNA
  113. Danionella cerebrum tRNA-Gln
  114. Danionella translucida tRNA
  115. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-6-1, tRNA-Gln-TTG-6-2)
  116. Dreissena polymorpha (Zebra mussel) transfer RNA glutamine (anticodon UUG)
  117. Dromaius novaehollandiae (emu) tRNA
  118. Dromas ardeola tRNA
  119. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon UUG)
  120. Drosophila ananassae tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  121. Drosophila arizonae (Fruit fly) tRNA-Gln
  122. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon UUG)
  123. Drosophila bipectinata (Pomace flies) transfer RNA glutamine (anticodon UUG)
  124. Drosophila busckii (Fruit fly) tRNA-Gln
  125. Drosophila elegans (Pomace flies) tRNA-Gln
  126. Drosophila erecta tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  127. Drosophila eugracilis (Fruit fly) tRNA-Gln
  128. Drosophila ficusphila (Fruit fly) tRNA-Gln
  129. Drosophila grimshawi tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  130. Drosophila guanche (Fruit fly) tRNA-Gln
  131. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon UUG)
  132. Drosophila hydei (Fruit fly) tRNA-Gln
  133. Drosophila innubila (Fruit fly) tRNA-Gln
  134. Drosophila kikkawai (Pomace flies) transfer RNA glutamine (anticodon UUG)
  135. Drosophila mauritiana (Fruit fly) tRNA-Gln
  136. Drosophila miranda (Fruit fly) tRNA-Gln
  137. Drosophila mojavensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  138. Drosophila montana (Pomace flies) transfer RNA glutamine (anticodon UUG)
  139. Drosophila nasuta (Pomace flies) transfer RNA glutamine (anticodon UUG)
  140. Drosophila navojoa (Fruit fly) tRNA-Gln
  141. Drosophila novamexicana (Pomace flies) tRNA-Gln
  142. Drosophila obscura (Fruit fly) tRNA-Gln
  143. Drosophila persimilis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  144. Drosophila pseudoobscura (Fruit fly) tRNA-Gln
  145. Drosophila pseudoobscura pseudoobscura tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  146. Drosophila rhopaloa (Fruit fly) tRNA-Gln
  147. Drosophila santomea (Fruit fly) tRNA-Gln
  148. Drosophila sechellia (Fruit fly) tRNA-Gln
  149. Drosophila serrata (Pomace flies) tRNA-Gln
  150. Drosophila simulans tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  151. Drosophila subobscura (Fruit fly) tRNA-Gln
  152. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  153. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glutamine (anticodon UUG)
  154. Drosophila suzukii (Pomace flies) transfer RNA glutamine (anticodon UUG)
  155. Drosophila takahashii (Pomace flies) transfer RNA glutamine (anticodon UUG)
  156. Drosophila teissieri (Fruit fly) tRNA-Gln
  157. Drosophila tropicalis (Pomace flies) transfer RNA glutamine (anticodon UUG)
  158. Drosophila virilis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  159. Drosophila willistoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  160. Drosophila yakuba tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  161. Egretta garzetta tRNA
  162. Electrophorus electricus (electric eel) tRNA
  163. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  164. Erpetoichthys calabaricus (reedfish) tRNA
  165. Esox lucius (northern pike) tRNA
  166. Eubucco bourcierii (red-headed barbet) tRNA
  167. Eudromia elegans (elegant crested-tinamou) tRNA
  168. Eudyptes chrysocome (Rockhopper penguin) tRNA
  169. Eudyptula minor (little blue penguin) tRNA
  170. Eumeta japonica tRNA
  171. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  172. Eurypyga helias (sunbittern) tRNA
  173. Eurystomus gularis tRNA
  174. Falco tinnunculus (common kestrel) tRNA
  175. Fregata magnificens tRNA
  176. Fregetta grallaria tRNA
  177. Fulmarus glacialis (northern fulmar) tRNA
  178. Gadus morhua (Atlantic cod) tRNA
  179. Gadus morhua 'NCC' tRNA-Gln
  180. Galbula dea tRNA
  181. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  182. Gammaproteobacteria bacterium tRNA-Gln
  183. Gavia stellata tRNA
  184. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  185. Geococcyx californianus tRNA
  186. Glareola pratincola tRNA
  187. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  188. Glossina austeni tRNA tRNA-Gln
  189. Glossina brevipalpis tRNA tRNA-Gln
  190. Glossina fuscipes fuscipes tRNA
  191. Glossina fuscipes (Tsetse fly) tRNA-Gln
  192. Glossina morsitans morsitans tRNA tRNA-Gln
  193. Glossina pallidipes tRNA tRNA-Gln
  194. Glossina palpalis gambiensis tRNA tRNA-Gln
  195. Gopherus agassizii (desert tortoise) tRNA
  196. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  197. Gymnothorax javanicus tRNA-Gln
  198. Halcyon senegalensis tRNA
  199. Haliaeetus albicilla tRNA
  200. Helobdella robusta (Freshwater leech) tRNA-Gln for anticodon UUG
  201. Herpetotheres cachinnans tRNA
  202. Himantopus himantopus (black-winged stilt) tRNA
  203. Hucho hucho (huchen) tRNA
  204. Hydractinia symbiolongicarpus (Hydrozoan) transfer RNA glutamine (anticodon UUG)
  205. Ibidorhyncha struthersii tRNA
  206. Indicator maculatus tRNA
  207. Jacana jacana (wattled jacana) tRNA
  208. Labeo rohita (rohu) tRNA
  209. Laticauda laticaudata (blue-ringed sea krait) tRNA
  210. Limosa lapponica baueri tRNA
  211. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015026027.1
  212. Lingula anatina (Lamp shell) tRNA-Gln
  213. Lonchura striata tRNA
  214. Lophotis ruficrista tRNA
  215. Lucilia cuprina tRNA-Gln for anticodon UUG
  216. Lucilia sericata (Common green bottle fly) tRNA-Gln
  217. Lutzomyia longipalpis tRNA tRNA-Gln
  218. Mauremys mutica tRNA
  219. Megalops atlanticus (tarpon) tRNA
  220. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  221. Mercenaria mercenaria (Northern quahog) transfer RNA glutamine (anticodon UUG)
  222. Mesembrinibis cayennensis tRNA
  223. Mesitornis unicolor (brown roatelo) tRNA
  224. Mizuhopecten yessoensis (Yesso scallop) tRNA-Gln
  225. Muntiacus reevesi (Chinese muntjac) tRNA
  226. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  227. Musca domestica (House fly) transfer RNA glutamine (anticodon UUG)
  228. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon UUG)
  229. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013329.1
  230. Myripristis murdjan (pinecone soldierfish) tRNA
  231. Naja naja tRNA
  232. Nestor notabilis tRNA
  233. Nipponia nippon (crested ibis) tRNA
  234. Notechis scutatus tRNA
  235. Nothocercus julius tRNA
  236. Nothoprocta ornata tRNA
  237. Nothoprocta perdicaria tRNA
  238. Nyctibius bracteatus tRNA
  239. Nycticryphes semicollaris tRNA
  240. Nyctiprogne leucopyga tRNA
  241. Oceanites oceanicus tRNA
  242. Oceanodroma tethys tRNA
  243. Octopus bimaculoides (California two-spot octopus) transfer RNA glutamine (anticodon UUG)
  244. Octopus sinensis tRNA-Gln
  245. Octopus vulgaris (common octopus) tRNA
  246. Odocoileus virginianus texanus tRNA
  247. Odontophorus gujanensis (marbled wood quail) tRNA
  248. Oncorhynchus kisutch (coho salmon) tRNA
  249. Oncorhynchus mykiss (rainbow trout) tRNA
  250. Oncorhynchus tshawytscha (Chinook salmon) tRNA
  251. Onychostoma macrolepis tRNA
  252. Ophiophagus hannah tRNA
  253. Oreotrochilus melanogaster tRNA
  254. Ornithorhynchus anatinus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  255. Otus sunia (Oriental scops-owl) tRNA
  256. Owenia fusiformis tRNA
  257. Pandion haliaetus tRNA
  258. Pantherophis guttatus tRNA
  259. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  260. Patagioenas fasciata monilis tRNA
  261. Pavo cristatus (Indian peafowl) tRNA
  262. Pecten maximus (Great Scallop) tRNA-Gln
  263. Pelecanoides urinatrix tRNA
  264. Pelecanus crispus tRNA
  265. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  266. Pelusios castaneus tRNA
  267. Phaethon lepturus tRNA
  268. Phaetusa simplex (large-billed tern) tRNA
  269. Phalacrocorax carbo (great cormorant) tRNA
  270. Phasianus colchicus (Ring-necked pheasant) tRNA
  271. Phlebotomus papatasi tRNA tRNA-Gln
  272. Phoenicopterus ruber ruber tRNA
  273. Phrynocephalus forsythii tRNA
  274. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  275. Piaya cayana (squirrel cuckoo) tRNA
  276. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  277. Platysternon megacephalum (big-headed turtle) tRNA
  278. Pluvianellus socialis (magellanic plover) tRNA
  279. Podarcis lilfordi tRNA
  280. Podarcis muralis tRNA
  281. Podiceps cristatus (great crested grebe) tRNA
  282. Podilymbus podiceps tRNA
  283. Polypterus senegalus tRNA
  284. Probosciger aterrimus tRNA
  285. Pseudomonadota bacterium tRNA-Gln
  286. Pseudonaja textilis tRNA
  287. Psilopogon haemacephalus tRNA
  288. Pterocles burchelli tRNA
  289. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  290. Pygoscelis adeliae (Adelie penguin) tRNA
  291. Pygoscelis papua tRNA
  292. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  293. Ramphastos sulfuratus tRNA
  294. Rhagoletis pomonella tRNA-Gln
  295. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  296. Rissa tridactyla (black-legged kittiwake) tRNA
  297. Rostratula benghalensis (greater painted-snipe) tRNA
  298. Sagittarius serpentarius tRNA
  299. Salmo salar (Atlantic salmon) tRNA
  300. Salmo trutta (brown trout) tRNA
  301. Salvelinus namaycush (lake trout) tRNA
  302. Scaptodrosophila lebanonensis tRNA
  303. Scleropages formosus tRNA
  304. Scopus umbretta (hamerkop) tRNA
  305. Acanthosepion pharaonis Sepia pharaonis tRNA
  306. Sergentomyia squamirostris tRNA-Gln
  307. Sinocyclocheilus anshuiensis tRNA
  308. Sinocyclocheilus grahami tRNA
  309. Sinocyclocheilus rhinocerous tRNA
  310. Sphaerodactylus townsendi tRNA-Gln
  311. Sphenodon punctatus (tuatara) tRNA
  312. Spizaetus tyrannus (black hawk-eagle) tRNA
  313. Stomoxys calcitrans (stable fly) transfer RNA glutamine (anticodon UUG)
  314. Strigamia maritima (Soil centipede) tRNA-Gln for anticodon UUG
  315. Strigops habroptila (kakapo) tRNA
  316. Strix occidentalis caurina tRNA
  317. Struthio camelus australis tRNA
  318. Sula dactylatra tRNA
  319. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  320. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  321. Tauraco erythrolophus (red-crested turaco) tRNA
  322. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Gln
  323. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  324. Thalassarche chlororhynchos tRNA
  325. Thamnophis sirtalis tRNA
  326. Tinamus guttatus tRNA
  327. Todus mexicanus (puerto rican tody) tRNA
  328. Tricholaema leucomelas (pied barbet) tRNA
  329. Triplophysa rosa (cave loach) tRNA
  330. Triplophysa tibetana tRNA
  331. Trogon melanurus (black-tailed trogon) tRNA
  332. Salvator merianae Tupinambis merianae tRNA
  333. uncultured Gammaproteobacteria bacterium transfer RNA
  334. Upupa epops (Eurasian hoopoe) tRNA
  335. Uranotaenia lowii (Mosquitos) transfer RNA glutamine (anticodon UUG)
  336. Varanus komodoensis tRNA
  337. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon UUG)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications