Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Myripristis murdjan (pinecone soldierfish) tRNA secondary structure diagram

Myripristis murdjan (pinecone soldierfish) tRNA URS0000368249_586833

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCUAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUAGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 320 other species

  1. Acanthisitta chloris tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acrocephalus arundinaceus (great reed warbler) tRNA
  4. Aegotheles bennettii tRNA
  5. Albula glossodonta (roundjaw bonefish) tRNA
  6. Albula goreensis tRNA
  7. Alca torda tRNA
  8. Ceyx cyanopectus Alcedo cyanopecta tRNA
  9. Alectura lathami (australian brush-turkey) tRNA
  10. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  11. Alligator sinensis (Chinese alligator) tRNA
  12. Alosa alosa (allis shad) tRNA-Gln
  13. Amazona aestiva tRNA
  14. Amazona collaria (yellow-billed parrot) tRNA
  15. Amazona guildingii tRNA
  16. Anabarilius grahami tRNA
  17. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  18. Anas platyrhynchos tRNA
  19. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon UUG)
  20. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon UUG)
  21. Anas zonorhyncha tRNA
  22. Anguilla anguilla tRNA
  23. Anhinga anhinga tRNA
  24. Anhinga rufa (African darter) tRNA
  25. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1)
  26. Anseranas semipalmata (magpie goose) tRNA
  27. Anser brachyrhynchus (pink-footed goose) tRNA
  28. Anser cygnoides (Chinese goose) tRNA
  29. Aphidius gifuensis (Parasitoid wasp) tRNA-Gln
  30. Aptenodytes forsteri (emperor penguin) tRNA
  31. Aptenodytes patagonicus (king penguin) tRNA
  32. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  33. Apteryx owenii (little spotted kiwi) tRNA
  34. Aquila chrysaetos chrysaetos tRNA
  35. Aramus guarauna (limpkin) tRNA
  36. Arctogadus glacialis (Arctic cod) tRNA-Gln
  37. Ardeotis kori tRNA
  38. Arenaria interpres (ruddy turnstone) tRNA
  39. Asarcornis scutulata tRNA
  40. Astyanax mexicanus (Mexican tetra) tRNA
  41. Atlantisia rogersi (inaccessible island rail) tRNA
  42. Aythya fuligula (tufted duck) tRNA
  43. Bacteroidota bacterium tRNA-Gln
  44. Bactrocera dorsalis (Oriental fruit fly) tRNA-Gln
  45. Bactrocera latifrons tRNA-Gln
  46. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon UUG)
  47. Bactrocera tryoni (Queensland fruitfly) tRNA-Gln
  48. Balaeniceps rex (shoebill) tRNA
  49. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  50. Baryphthengus martii tRNA
  51. Belgica antarctica tRNA-Gln for anticodon UUG
  52. Biomphalaria glabrata tRNA tRNA-Gln
  53. Biomphalaria pfeifferi tRNA-Gln
  54. Bison bison bison (north american plains bison) tRNA
  55. Boreogadus saida tRNA-Gln
  56. Bos grunniens (domestic yak) tRNA
  57. Bos mutus Bos grunniens mutus tRNA
  58. Bos indicus tRNA
  59. Bos indicus x Bos taurus (hybrid cattle) tRNA
  60. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  61. Pseudolycoriella hygida Bradysia hygida tRNA
  62. Branchiostoma floridae (Florida lancelet) tRNA
  63. Bugula neritina tRNA
  64. Burhinus bistriatus tRNA
  65. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  66. Callipepla squamata (scaled quail) tRNA
  67. Calonectris borealis (cory's shearwater) tRNA
  68. Calypte anna (Anna's hummingbird) tRNA
  69. Capra hircus (goat) tRNA
  70. Antrostomus carolinensis tRNA
  71. Carassius auratus (goldfish) tRNA
  72. Cariama cristata (red-legged seriema) tRNA
  73. Cathartes aura (turkey vulture) tRNA
  74. Centropus unirufus tRNA
  75. Cepphus grylle tRNA
  76. Ceratitis capitata tRNA-Gln
  77. Cervus elaphus hippelaphus tRNA
  78. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  79. Chaetura pelagica (chimney swift) tRNA
  80. Chanos chanos (milkfish) tRNA
  81. Charadrius vociferus tRNA
  82. Chelonia mydas (green seaturtle) tRNA
  83. Chelydra serpentina (snapping turtle) tRNA
  84. Chionis minor (black-faced sheathbill) tRNA
  85. Chloroceryle aenea tRNA
  86. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  87. Chrysolophus pictus (golden pheasant) tRNA
  88. Chunga burmeisteri (black-legged seriema) tRNA
  89. Ciconia maguari tRNA
  90. Circaetus pectoralis tRNA
  91. Clunio marinus tRNA
  92. Clupea harengus (Atlantic herring) tRNA
  93. Clytia hemisphaerica tRNA-Gln for anticodon UUG
  94. Cochlearius cochlearius tRNA
  95. Colinus virginianus (northern bobwhite) tRNA
  96. Columba livia (Rock pigeon) tRNA
  97. Columbina picui (picui ground-dove) tRNA
  98. Conger conger tRNA
  99. Coregonus sp. 'balchen' tRNA
  100. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015298.1
  101. Corythaixoides concolor (grey go-away-bird) tRNA
  102. Coturnix japonica (Japanese quail) tRNA
  103. Crocodylus porosus (Australian saltwater crocodile) tRNA
  104. Crotophaga sulcirostris (groove-billed ani) tRNA
  105. Cuculus canorus (common cuckoo) tRNA
  106. Cyanobacteria bacterium J06582_2 tRNA-Gln
  107. Cyprinus carpio carpio tRNA
  108. Cyprinus carpio (common carp) tRNA
  109. Danionella cerebrum tRNA-Gln
  110. Danionella translucida tRNA
  111. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-6-1, tRNA-Gln-TTG-6-2)
  112. Dreissena polymorpha (Zebra mussel) transfer RNA glutamine (anticodon UUG)
  113. Dromaius novaehollandiae (emu) tRNA
  114. Dromas ardeola tRNA
  115. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon UUG)
  116. Drosophila ananassae tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  117. Drosophila arizonae (Fruit fly) tRNA-Gln
  118. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon UUG)
  119. Drosophila bipectinata (Fruit fly) tRNA-Gln
  120. Drosophila busckii (Fruit fly) tRNA-Gln
  121. Drosophila elegans (Fruit fly) tRNA-Gln
  122. Drosophila erecta tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  123. Drosophila eugracilis (Fruit fly) tRNA-Gln
  124. Drosophila ficusphila (Fruit fly) tRNA-Gln
  125. Drosophila grimshawi tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  126. Drosophila guanche (Fruit fly) tRNA-Gln
  127. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon UUG)
  128. Drosophila hydei (Fruit fly) tRNA-Gln
  129. Drosophila innubila (Fruit fly) tRNA-Gln
  130. Drosophila kikkawai (Fruit fly) tRNA-Gln
  131. Drosophila mauritiana (Fruit fly) tRNA-Gln
  132. Drosophila melanogaster transfer RNA:Glutamine-TTG 1-3 (Dmel_CR31070, Dmel_CR31071, Dmel_CR32093)
  133. Drosophila miranda (Fruit fly) tRNA-Gln
  134. Drosophila mojavensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  135. Drosophila navojoa (Fruit fly) tRNA-Gln
  136. Drosophila obscura (Fruit fly) tRNA-Gln
  137. Drosophila persimilis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  138. Drosophila pseudoobscura (Fruit fly) tRNA-Gln
  139. Drosophila pseudoobscura pseudoobscura tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  140. Drosophila rhopaloa (Fruit fly) tRNA-Gln
  141. Drosophila santomea (Fruit fly) tRNA-Gln
  142. Drosophila sechellia (Fruit fly) tRNA-Gln
  143. Drosophila simulans tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  144. Drosophila subobscura (Fruit fly) tRNA-Gln
  145. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  146. Drosophila suzukii (Fruit fly) tRNA-Gln
  147. Drosophila takahashii (Fruit fly) tRNA-Gln
  148. Drosophila teissieri (Fruit fly) tRNA-Gln
  149. Drosophila virilis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  150. Drosophila willistoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  151. Drosophila yakuba tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 4)
  152. Egretta garzetta tRNA
  153. Electrophorus electricus (electric eel) tRNA
  154. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  155. Erpetoichthys calabaricus (reedfish) tRNA
  156. Esox lucius (northern pike) tRNA
  157. Eubucco bourcierii (red-headed barbet) tRNA
  158. Eudromia elegans (elegant crested-tinamou) tRNA
  159. Eudyptes chrysocome (Rockhopper penguin) tRNA
  160. Eudyptula minor (little blue penguin) tRNA
  161. Eumeta japonica tRNA
  162. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  163. Eurypyga helias (sunbittern) tRNA
  164. Eurystomus gularis tRNA
  165. Falco tinnunculus (common kestrel) tRNA
  166. Fregata magnificens tRNA
  167. Fregetta grallaria tRNA
  168. Fulmarus glacialis (northern fulmar) tRNA
  169. Gadus morhua (Atlantic cod) tRNA
  170. Gadus morhua 'NCC' tRNA-Gln
  171. Galbula dea tRNA
  172. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  173. Gavia stellata tRNA
  174. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  175. Geococcyx californianus tRNA
  176. Glareola pratincola tRNA
  177. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  178. Glossina austeni (Tsetse fly) tRNA tRNA-Gln
  179. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gln
  180. Glossina fuscipes fuscipes tRNA
  181. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  182. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gln
  183. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Gln
  184. Gopherus agassizii (desert tortoise) tRNA
  185. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  186. Halcyon senegalensis tRNA
  187. Haliaeetus albicilla tRNA
  188. Helobdella robusta tRNA-Gln for anticodon UUG
  189. Herpetotheres cachinnans tRNA
  190. Himantopus himantopus (black-winged stilt) tRNA
  191. Hucho hucho (huchen) tRNA
  192. Hydractinia symbiolongicarpus (Hydrozoan) transfer RNA glutamine (anticodon UUG)
  193. Ibidorhyncha struthersii tRNA
  194. Indicator maculatus tRNA
  195. Jacana jacana (wattled jacana) tRNA
  196. Labeo rohita (rohu) tRNA
  197. Laticauda laticaudata (blue-ringed sea krait) tRNA
  198. Limosa lapponica baueri tRNA
  199. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015026027.1
  200. Lingula anatina tRNA-Gln
  201. Lonchura striata domestica (Bengalese finch) tRNA
  202. Lophotis ruficrista tRNA
  203. Lucilia cuprina (Australian sheep blowfly) tRNA-Gln for anticodon UUG
  204. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Gln
  205. Mauremys mutica tRNA
  206. Megalops atlanticus tRNA
  207. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  208. Mercenaria mercenaria (Hard clam (quahog)) tRNA-Gln
  209. Mesembrinibis cayennensis tRNA
  210. Mesitornis unicolor (brown roatelo) tRNA
  211. Mizuhopecten yessoensis (Yesso scallop) tRNA-Gln
  212. Muntiacus reevesi (Chinese muntjac) tRNA
  213. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  214. Musca domestica (House fly) tRNA MDOA014696
  215. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon UUG)
  216. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005012947.1
  217. Naja naja tRNA
  218. Nestor notabilis tRNA
  219. Nipponia nippon (crested ibis) tRNA
  220. Notechis scutatus tRNA
  221. Nothocercus julius tRNA
  222. Nothoprocta ornata tRNA
  223. Nothoprocta perdicaria tRNA
  224. Nyctibius bracteatus tRNA
  225. Nycticryphes semicollaris tRNA
  226. Nyctiprogne leucopyga tRNA
  227. Oceanites oceanicus tRNA
  228. Oceanodroma tethys tRNA
  229. Octopus bimaculoides (California two-spot octopus) transfer RNA glutamine (anticodon UUG)
  230. Octopus sinensis (East Asian common octopus) tRNA-Gln
  231. Octopus vulgaris (common octopus) tRNA
  232. Odocoileus virginianus texanus tRNA
  233. Odontophorus gujanensis (marbled wood quail) tRNA
  234. Oncorhynchus kisutch (coho salmon) tRNA
  235. Oncorhynchus mykiss (rainbow trout) tRNA
  236. Oncorhynchus tshawytscha (Chinook salmon) tRNA
  237. Onychostoma macrolepis tRNA
  238. Ophiophagus hannah (king cobra) tRNA
  239. Oreotrochilus melanogaster tRNA
  240. Ornithorhynchus anatinus tRNA-Gln (TTG) (tRNA-Gln-TTG-3-1, tRNA-Gln-TTG-3-2)
  241. Otus sunia (Oriental scops-owl) tRNA
  242. Owenia fusiformis tRNA
  243. Pandion haliaetus tRNA
  244. Pantherophis guttatus tRNA
  245. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  246. Patagioenas fasciata monilis tRNA
  247. Pavo cristatus (Indian peafowl) tRNA
  248. Pecten maximus (Great Scallop) tRNA-Gln
  249. Pelecanoides urinatrix tRNA
  250. Pelecanus crispus tRNA
  251. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  252. Pelusios castaneus tRNA
  253. Phaethon lepturus tRNA
  254. Phaetusa simplex (large-billed tern) tRNA
  255. Phalacrocorax carbo (great cormorant) tRNA
  256. Phasianus colchicus (Ring-necked pheasant) tRNA
  257. Phlebotomus papatasi (Sand fly) tRNA tRNA-Gln
  258. Phoenicopterus ruber ruber tRNA
  259. Phrynocephalus forsythii tRNA
  260. Phrynosoma platyrhinos tRNA-OTHER
  261. Piaya cayana (squirrel cuckoo) tRNA
  262. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  263. Platysternon megacephalum (big-headed turtle) tRNA
  264. Pluvianellus socialis (magellanic plover) tRNA
  265. Podarcis lilfordi tRNA
  266. Podarcis muralis tRNA
  267. Podiceps cristatus (great crested grebe) tRNA
  268. Podilymbus podiceps tRNA
  269. Polypterus senegalus tRNA
  270. Probosciger aterrimus tRNA
  271. Pseudomonadota bacterium tRNA-Gln
  272. Pseudonaja textilis tRNA
  273. Psilopogon haemacephalus tRNA
  274. Pterocles burchelli tRNA
  275. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  276. Pygoscelis adeliae (Adelie penguin) tRNA
  277. Pygoscelis papua tRNA
  278. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  279. Ramphastos sulfuratus tRNA
  280. Rhagoletis pomonella tRNA-Gln
  281. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  282. Rissa tridactyla (black-legged kittiwake) tRNA
  283. Rostratula benghalensis (greater painted-snipe) tRNA
  284. Sagittarius serpentarius tRNA
  285. Salmo salar (Atlantic salmon) tRNA
  286. Salmo trutta (brown trout) tRNA
  287. Salvelinus namaycush (lake trout) tRNA
  288. Scaptodrosophila lebanonensis tRNA
  289. Scleropages formosus tRNA
  290. Scopus umbretta (hamerkop) tRNA
  291. Acanthosepion pharaonis Sepia pharaonis tRNA
  292. Sergentomyia squamirostris tRNA-Gln
  293. Sinocyclocheilus anshuiensis tRNA
  294. Sinocyclocheilus grahami tRNA
  295. Sinocyclocheilus rhinocerous tRNA
  296. Sphaerodactylus townsendi tRNA-Gln
  297. Sphenodon punctatus (tuatara) tRNA
  298. Spizaetus tyrannus (black hawk-eagle) tRNA
  299. Stomoxys calcitrans tRNA-Gln
  300. Strigamia maritima tRNA-Gln for anticodon UUG
  301. Strigops habroptila (kakapo) tRNA
  302. Strix occidentalis caurina tRNA
  303. Struthio camelus australis tRNA
  304. Sula dactylatra tRNA
  305. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  306. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  307. Tauraco erythrolophus (red-crested turaco) tRNA
  308. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  309. Thalassarche chlororhynchos tRNA
  310. Thamnophis sirtalis tRNA
  311. Tinamus guttatus tRNA
  312. Todus mexicanus (puerto rican tody) tRNA
  313. Tricholaema leucomelas (pied barbet) tRNA
  314. Triplophysa rosa (cave loach) tRNA
  315. Triplophysa tibetana tRNA
  316. Trogon melanurus (black-tailed trogon) tRNA
  317. Salvator merianae Tupinambis merianae tRNA
  318. uncultured Gammaproteobacteria bacterium transfer RNA
  319. Upupa epops (Eurasian hoopoe) tRNA
  320. Uranotaenia lowii (Mosquitos) transfer RNA glutamine (anticodon UUG)
  321. Varanus komodoensis tRNA
  322. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon UUG)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...