Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-2682-5p URS0000366551_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2682: Hsa-mir-2682 is a highly expressed miRNA of the central nervous system (CNS) and brain cortex [PMC9680243]. It is a precursor of hsa-miR-137 and MIR137HG [PMC9680243]. Hsa_circ_0131242 has been identified as a sponge for hsa-mir-2682 [PMC7947672]. Co-transfection of hsa-mir-2682 repressor and si-hsa_circ_0131242 has been shown to inhibit cell proliferation and migration in breast cancer cell lines [PMC7947672]. Hsa-mir-2682, along with other miRNAs, has low expression in tumor tissue, with more than 20% of samples showing no expression [PMC5912208]. Knockdown of hsa_circ_0131242 enhances the expression of hsa-mir-2682 in breast cancer cell lines [PMC7261810]. Luciferase reporter assays have confirmed the target binding between hsa-mir-2682 and hsa_circ_0131242 [PMC7261810]. Hsa_circ_0131242 acts as a sponge for hsa-mir-2682, regulating breast cancer progression [PMC7261810]. Co-transfection of hsa-mir-2682 inhibitor and si-hsa_circ_0131242 in cells further supports the role of hsa_circ_0131242 as a regulator for breast cancer progression by sponging hsa-mir-2682 [PMC7261810]. The mechanism by which circRNAs function as miRNA sponges to regulate gene expression is still being explored, but previous studies have shown similar interactions between circRNAs and miRNAs in other cancers [PMC7261810].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCAGUGACUGUUCAGACGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications