Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-183-3p URS0000345DEB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-183: Hsa-mir-183 is a microRNA that has been found to have frequent aberrant DNA methylation at its promoter [PMC5340808]. In a study, 791 miRNAs that interacted with 137 downregulated "seeds" were analyzed, and it was discovered that 22 miRNAs, including hsa-mir-183, were upregulated and could predict gene expression regulation in prostate cancer (PCa) [PMC8426106]. The other upregulated miRNAs identified in the study were hsa-mir-500a, hsa-mir-17, hsa-mir-425, hsa-mir-20b, hsa-mir-508, hsa-mir-3074, hsa-mir-106a, hsa-mir-25, hsa-mir-18a, hsa-mir-342, hsa-mir-20a, has-miR93 has-, mir3653 has-, mir561 has-, mir200c has-, mir96 has-, mir148a has-, mir1304 has-, mir146b and the other two are not mentioned in the context [PMC8426106]. These findings suggest that aberrant DNA methylation at the promoter of miR183 may play a role in PCa development and progression [PMC5340808]. The dysregulation of these miRNAs could potentially be used as biomarkers for PCa diagnosis and prognosis [PMC8426106]. Further research is needed to fully understand the mechanisms by which these miRNAs regulate gene expression in PCa [PMC8426106].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAUUACCGAAGGGCCAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Mus musculus mmu-miR-183-3p
Publications