Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-103a URS0000345516_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Alligator mississippiensis (American alligator) ami-miR-107-3p
  2. Bos taurus (cattle) microRNA miR-103
  3. Callorhinchus milii eshark_mir-103_1
  4. Canis lupus familiaris (dog) cfa-miR-107
  5. Capra hircus (goat) chi-miR-107-3p
  6. Cervus elaphus (red deer) cel-miR-107
  7. Chrysemys picta cpi-miR-103-3p
  8. Columba livia cli-miR-107-3p
  9. Homo sapiens (human) microRNA mir-107
  10. Microcebus murinus (gray mouse lemur) mmr-miR-107
  11. Mus musculus Mus_musculus piRNA piR-mmu-72438
  12. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-107
  13. Oryzias latipes ola-miR-103
  14. Otolemur garnettii (small-eared galago) oga-miR-107
  15. Papio hamadryas (hamadryas baboon) pha-miR-107
  16. Pteropus alecto pal-miR-107a-3p
  17. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62828
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-107
  19. Xenopus laevis (African clawed frog) xla-miR-107-3p
  20. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2769792