v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62828 URS0000345516_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAGCAUUGUACAGGGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Alligator mississippiensis (American alligator) ami-miR-107-3p
  2. Bos taurus (cattle) microRNA miR-103
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-103a
  4. Callorhinchus milii eshark_mir-103_1
  5. Canis lupus familiaris (dog) cfa-miR-107
  6. Capra hircus (goat) chi-miR-107-3p
  7. Cervus elaphus (red deer) cel-miR-107
  8. Chrysemys picta cpi-miR-103-3p
  9. Columba livia cli-miR-107-3p
  10. Homo sapiens (human) microRNA mir-107
  11. Microcebus murinus (gray mouse lemur) mmr-miR-107
  12. Mus musculus Mus_musculus piRNA piR-mmu-72438
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-107
  14. Oryzias latipes ola-miR-103
  15. Otolemur garnettii (small-eared galago) oga-miR-107
  16. Papio hamadryas (hamadryas baboon) pha-miR-107
  17. Pteropus alecto pal-miR-107a-3p
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-107
  19. Xenopus laevis (African clawed frog) xla-miR-107-3p
  20. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2769792