Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-34a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-34a precursor URS000033F823_9600

110 nucleotides
2 databases (ENA, miRBase)
Found in 10 other species
1 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Gorilla gorilla gorilla ggo-mir-34a (ENSGGOG00000032985.2)
Gorilla gorilla microRNA ggo-mir-34a precursor
Homo sapiens microRNA hsa-mir-34a precursor
Pan paniscus microRNA ppa-mir-34a precursor
Pan troglodytes microRNA ptr-mir-34a precursor
Pongo abelii microRNA 34a (ENSPPYG00000021320.2)

Publications