v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Salmo salar (Atlantic salmon) ssa-miR-155-5p secondary structure diagram

Salmo salar (Atlantic salmon) ssa-miR-155-5p URS0000338542_8030

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAAUGCUAAUCGUGAUAGGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus (domestic cattle) bta-miR-155
  2. Canis lupus familiaris cfa-miR-155
  3. Capra hircus (goat) chi-miR-155-5p
  4. Cervus elaphus (red deer) cel-miR-155
  5. Columba livia (rock pigeon) cli-miR-155-5p
  6. Equus caballus (horse) eca-miR-155
  7. Gadus morhua gmo-miR-155-5p
  8. Haplochromis burtoni abu-miR-155
  9. Homo sapiens (human) hsa-miR-155-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-155
  11. Maylandia zebra (zebra mbuna) mze-miR-155
  12. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-155_5p (mature (guide))
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-155
  14. Notamacropus eugenii (tammar wallaby) Neu-Mir-155_5p (mature (guide))
  15. Oreochromis niloticus oni-miR-155
  16. Ornithorhynchus anatinus oan-miR-155-5p
  17. Pan troglodytes ptr-miR-155
  18. Papio hamadryas (hamadryas baboon) pha-miR-155
  19. Pongo pygmaeus ppy-miR-155
  20. Pteropus alecto pal-miR-155-5p
  21. Pundamilia nyererei pny-miR-155
  22. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-155_5p (mature (guide))
  23. Tetraodon nigroviridis Tni-Mir-155_5p (mature (guide))
  24. Tupaia belangeri chinensis tch-miR-155-5p
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications