Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U1 small nuclear 1 (RNU1 1 to 4, RNVU1-18, RNVU1-29) secondary structure diagram

Homo sapiens (human) RNA, U1 small nuclear 1 (RNU1 1 to 4, RNVU1-18, RNVU1-29) URS000032B6B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU1-2: RNU1-2 is a member of the RNA U1 family and is a non-polyadenylated uridine-rich small nuclear RNA (UsnRNA) [PMC4931115]. The impact of BRAT1 deletion on the 3' end processing of non-polyadenylated UsnRNAs, including RNU1-2, was investigated using quantitative reverse-transcription PCR (RT-qPCR) [PMC9418311]. The role of RNU1-2 in innate immune activation was further supported by the finding that alterations in RNU1-2 expression were associated with innate immune activation [PMC5815369]. RNU1-2, along with other genes from the RNA U1 family, regulates transcription, elongation, and pre-mRNA splicing events [PMC5062749]. Transcription read-through was observed at the RNU1-2 locus upon depletion of ARS2 and CBP80 [PMC3923317]. Up-regulation of RNU1-2 has been observed in KSHV+ PEL cell lines treated with a c-MET inhibitor [PMC5578886]. RNU43 is commonly used as a reference gene along with RNU1-2 in urological cancers [PMC8999557]. The stability of SNORD43 and its combination with RNU1-2 as reference genes has been demonstrated for studying c-miRNAs in urological malignancies [PMC6769746]. Functional roles have been identified for genes such as MALAT1, FENDRR, TUG1, and RNU1-2 in cell cycle regulation and splicing cycle events [PMC7290873]. In various studies, expression changes have been observed for genes such as SLC7A11 and KRTAP2-3 along with RNU11 upon different treatments or conditions [PMC8997840] [PMC7093963]. RNU1-2 has also been associated with maternal race effects [PMC8796169]. RNU1-2 is one of the genes induced upon PTS and is involved in transcript splicing [PMC7907328]. Additionally, RNU1-2 has been identified as a significantly differentially expressed gene in the analysis of STIR volume and STIR composite [PMC8741947].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUUACCUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGCGAGGCUUAUCCAUUGCACUCCGGAUGUGCUGACCCCUGCGAUUUCCCCAAAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUGCGUUCGCGCUUUCCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 75 other species

  1. Ailuropoda melanoleuca U1 spliceosomal RNA
  2. Aotus nancymaae U1 spliceosomal RNA (multiple genes)
  3. Balaenoptera musculus (Blue whale) U1 spliceosomal RNA (multiple genes)
  4. Bison bison bison U1 spliceosomal RNA (multiple genes)
  5. Bos grunniens (domestic yak) U1 spliceosomal RNA (multiple genes)
  6. Bos indicus x Bos taurus (hybrid cattle) U1 spliceosomal RNA (multiple genes)
  7. Bos mutus (wild yak) U1 spliceosomal RNA (multiple genes)
  8. Bos taurus U1 spliceosomal RNA (multiple genes)
  9. Callithrix jacchus U1 spliceosomal RNA (multiple genes)
  10. Camelus dromedarius (Arabian camel) U1 spliceosomal RNA (ENSCDRG00005015006.1, ENSCDRG00005015771.1, ENSCDRG00005022221.1)
  11. Camelus ferus U1 spliceosomal RNA
  12. Canis lupus dingo U1 spliceosomal RNA (ENSCAFG00020023559.1, ENSCAFG00020023563.1, ENSCAFG00020025958.1)
  13. Canis lupus familiaris U1 spliceosomal RNA (multiple genes)
  14. Capra hircus (Goat) U1 spliceosomal RNA (multiple genes)
  15. Cavia porcellus U1 spliceosomal RNA (ENSCPOG00000032235.1, ENSCPOG00000035886.1)
  16. Cebus imitator (Panamanian white-faced capuchin) U1 spliceosomal RNA (multiple genes)
  17. Cercocebus atys (Sooty mangabey) U1 spliceosomal RNA (multiple genes)
  18. Cervus elaphus hippelaphus ncRNA
  19. Cervus hanglu yarkandensis (Yarkand deer) U1 spliceosomal RNA (multiple genes)
  20. Chlorocebus sabaeus U1 spliceosomal RNA (multiple genes)
  21. Colobus angolensis palliatus U1 spliceosomal RNA (multiple genes)
  22. Delphinapterus leucas (beluga whale) U1 spliceosomal RNA (ENSDLEG00000006973.1, ENSDLEG00000017276.1)
  23. Equus asinus asinus U1 spliceosomal RNA (ENSEASG00005002753.1)
  24. Equus asinus U1 spliceosomal RNA (ENSEASG00005023961.1, ENSEASG00005037195.1)
  25. Equus caballus U1 spliceosomal RNA (ENSECAG00000028137.1, ENSECAG00000036574.1, ENSECAG00000040610.1)
  26. Felis catus (domestic cat) U1 spliceosomal RNA (multiple genes)
  27. Fukomys damarensis (Damara mole rat) U1 spliceosomal RNA (ENSFDAG00000004070.1)
  28. Gorilla gorilla gorilla U1 spliceosomal RNA (multiple genes)
  29. Heterocephalus glaber U1 spliceosomal RNA (ENSHGLG00000048137.1, ENSHGLG00100033600.1)
  30. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) U1 spliceosomal RNA (ENSSTOG00000019604.1, ENSSTOG00000021984.1)
  31. Loxodonta africana U1 spliceosomal RNA (multiple genes)
  32. Lynx canadensis U1 spliceosomal RNA (multiple genes)
  33. Macaca fascicularis U1 spliceosomal RNA (multiple genes)
  34. Macaca mulatta (Macaque) U1 spliceosomal RNA (multiple genes)
  35. Macaca nemestrina U1 spliceosomal RNA (multiple genes)
  36. Mandrillus leucophaeus U1 spliceosomal RNA (multiple genes)
  37. Marmota marmota marmota (Alpine marmot) U1 spliceosomal RNA (ENSMMMG00000020270.1)
  38. Marmota monax non-coding RNA
  39. Microcebus murinus U1 spliceosomal RNA (ENSMICG00000043877.1)
  40. Monodon monoceros (narwhal) U1 spliceosomal RNA (ENSMMNG00015017597.1)
  41. Moschus moschiferus U1 spliceosomal RNA (multiple genes)
  42. Mustela putorius furo U1 spliceosomal RNA (ENSMPUG00000021209.1, ENSMPUG00000022126.1, ENSMPUG00000023279.1)
  43. Neogale vison U1 spliceosomal RNA (ENSNVIG00000002890.1, ENSNVIG00000024220.1)
  44. Nomascus leucogenys U1 spliceosomal RNA (multiple genes)
  45. Otolemur garnettii U1 spliceosomal RNA (multiple genes)
  46. Ovis aries U1 spliceosomal RNA (multiple genes)
  47. Pan paniscus U1 spliceosomal RNA (ENSPPAG00000011577.1, ENSPPAG00000018041.1, ENSPPAG00000023642.1)
  48. Panthera leo U1 spliceosomal RNA (ENSPLOG00000001505.1, ENSPLOG00000001511.1)
  49. Panthera pardus (leopard) U1 spliceosomal RNA (ENSPPRG00000018997.1, ENSPPRG00000019011.1)
  50. Panthera tigris altaica (Tiger) U1 spliceosomal RNA (ENSPTIG00000000590.1)
  51. Pan troglodytes U1 spliceosomal RNA (multiple genes)
  52. Papio anubis U1 spliceosomal RNA (multiple genes)
  53. Phocoena sinus (vaquita) U1 spliceosomal RNA (multiple genes)
  54. Physeter catodon (sperm whale) U1 spliceosomal RNA (ENSPCTG00005009051.1, ENSPCTG00005011799.1)
  55. Piliocolobus tephrosceles (Ugandan red Colobus) U1 spliceosomal RNA (ENSPTEG00000012632.1, ENSPTEG00000032565.1, ENSPTEG00000032672.1, ENSPTEG00000037233.1)
  56. Pongo abelii (Sumatran orangutan) U1 spliceosomal RNA (multiple genes)
  57. Procavia capensis (cape rock hyrax) U1 spliceosomal RNA (ENSPCAG00000019511.1, ENSPCAG00000019625.1, ENSPCAG00000019864.1, ENSPCAG00000019883.1)
  58. Prolemur simus U1 spliceosomal RNA (ENSPSMG00000003843.1, ENSPSMG00000003851.1, ENSPSMG00000013079.1, ENSPSMG00000013081.1)
  59. Propithecus coquereli (Coquerel's sifaka) U1 spliceosomal RNA (ENSPCOG00000000552.1, ENSPCOG00000000570.1)
  60. Rhinopithecus bieti (Black snub-nosed monkey) U1 spliceosomal RNA (multiple genes)
  61. Rhinopithecus roxellana (Golden snub-nosed monkey) U1 spliceosomal RNA (ENSRROG00000000361.1, ENSRROG00000000465.1, ENSRROG00000018435.1)
  62. Saimiri boliviensis boliviensis U1 spliceosomal RNA (ENSSBOG00000006203.1)
  63. Sciurus vulgaris (Eurasian red squirrel) U1 spliceosomal RNA (ENSSVLG00005013784.1)
  64. Spermophilus dauricus (Daurian ground squirrel) U1 spliceosomal RNA (ENSSDAG00000020188.1, ENSSDAG00000024107.1)
  65. Suricata suricatta U1 spliceosomal RNA (ENSSSUG00005011116.1, ENSSSUG00005011151.1, ENSSSUG00005011164.1)
  66. Sus scrofa U1 spliceosomal RNA (multiple genes)
  67. Theropithecus gelada U1 spliceosomal RNA (multiple genes)
  68. Tupaia belangeri U1 spliceosomal RNA (ENSTBEG00000019049.1, ENSTBEG00000019220.1, ENSTBEG00000019257.1)
  69. Tupaia chinensis (Chinese tree shrew) U1 spliceosomal RNA
  70. Tursiops truncatus (bottlenosed dolphin) U1 spliceosomal RNA (ENSTTRG00000022529.1, ENSTTRG00000023397.1, ENSTTRG00000024126.1)
  71. Ursus americanus U1 spliceosomal RNA (ENSUAMG00000003401.1, ENSUAMG00000009888.1, ENSUAMG00000028008.1)
  72. Ursus maritimus U1 spliceosomal RNA (ENSUMAG00000010408.1, ENSUMAG00000022763.1)
  73. Ursus thibetanus thibetanus (Asiatic black bear) U1 spliceosomal RNA (ENSUTTG00000021205.1)
  74. Vicugna pacos (alpaca) U1 spliceosomal RNA (ENSVPAG00000015642.1, ENSVPAG00000017220.1)
  75. Vulpes vulpes (red fox) U1 spliceosomal RNA (ENSVVUG00000029956.1)
  76. Zalophus californianus (california sea lion) U1 spliceosomal RNA (multiple genes)
2D structure Publications