Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U1 small nuclear 4 secondary structure diagram

Homo sapiens (human) RNA, U1 small nuclear 4 URS000032B6B6_9606

  • 164 nucleotides
  • 10 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, IntAct, MalaCards, PDBe, RefSeq, Rfam)
  • Found in 413 species

Automated summary: This snRNA sequence is 164 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (GeneCards, HGNC, Ensembl/GENCODE, PDBe, IntAct, MalaCards, Rfam, ENA, RefSeq, Ensembl). Described in 35 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (U1, RF00003). Homo sapiens (human) RNA, U1 small nuclear 4 sequence is a product of RNU1-1, RNVU1-29, U1 snRNA, ENSG00000206737.1, RNVU1-18, RNU1, ENSG00000207005.1, RNU1-3, ENSG00000275405.1, RNU1-2, ENSG00000273768.1, ENSG00000207389.1, ENSG00000206652.1, RNU1-4, ENSG00000207513.1 genes. Found in the human reference genome.

Interactions 10

According to IntAct, Homo sapiens (human) RNA, U1 small nuclear 4 interacts with:

Interaction id Participant Synonyms
EBI-16411672 URS00004A7003_9606 EBI-11179166 URS00004A7003_9606 htr terc
EBI-16227449 URS000002FDBC_9606 EBI-15184845 URS000002FDBC_9606 snora 44
EBI-16227462 URS00002E0A2C_9606 EBI-15487001 URS00002E0A2C_9606 snord 21
EBI-16227482 URS00006422E6_9606 EBI-15554371 URS00006422E6_9606 snora 73b_u17b
EBI-16398210 URS000053962A_9606 EBI-16037563 URS000053962A_9606 snord3a_u3
EBI-16398270 URS000029360B_9606 EBI-16190517 URS000029360B_9606 snord55_u55
EBI-16398300 URS00005ACA64_9606 EBI-16210841 URS00005ACA64_9606 snord 94_u94
EBI-16412855 URS000000D517_9606 EBI-16412834 URS000000D517_9606 snora 74b_u19-2
EBI-16422811 intact:EBI-16419249 EBI-16419249 ENST00000316292 mrna_eef1a1
EBI-16422745 intact:EBI-16419667 EBI-16419667 HGNC:10354 NM_001035267 mra_rpl41

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUACUUACCUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGCGAGGCUUAUCCAUUGCACUCCGGAUGUGCUGACCCCUGCGAUUUCCCCAAAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUGCGUUCGCGCUUUCCCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 412 other species

    1. Ailuropoda melanoleuca U1 spliceosomal RNA
    2. Aotus nancymaae U1 spliceosomal RNA (multiple genes)
    3. Balaenoptera musculus U1 spliceosomal RNA (multiple genes)
    4. Bison bison bison (American bison) U1 spliceosomal RNA (multiple genes)
    5. Bos grunniens U1 spliceosomal RNA (multiple genes)
    6. Bos indicus x Bos taurus (hybrid cattle) U1 spliceosomal RNA (multiple genes)
    7. Bos mutus (wild yak) U1 spliceosomal RNA (multiple genes)
    8. Bos taurus (cattle) U1 spliceosomal RNA (multiple genes)
    9. Callithrix jacchus U1 spliceosomal RNA (multiple genes)
    10. Camelus dromedarius (Arabian camel) U1 spliceosomal RNA (ENSCDRG00005015006.1, ENSCDRG00005015771.1, ENSCDRG00005022221.1)
    11. Camelus ferus U1 spliceosomal RNA
    12. Canis lupus dingo (dingo) U1 spliceosomal RNA (ENSCAFG00020023559.1, ENSCAFG00020023563.1, ENSCAFG00020025958.1)
    13. Canis lupus familiaris U1 spliceosomal RNA (multiple genes)
    14. Capra hircus (Goat) U1 spliceosomal RNA (multiple genes)
    15. Cavia porcellus (domestic guinea pig) U1 spliceosomal RNA (ENSCPOG00000032235.1, ENSCPOG00000035886.1)
    16. Cercocebus atys (Sooty mangabey) U1 spliceosomal RNA (multiple genes)
    17. Cervus elaphus hippelaphus ncRNA
    18. Cervus hanglu yarkandensis U1 spliceosomal RNA (multiple genes)
    19. Chlorocebus sabaeus (African green monkey) U1 spliceosomal RNA (multiple genes)
    20. Colobus angolensis palliatus U1 spliceosomal RNA (multiple genes)
    21. Delphinapterus leucas (beluga whale) U1 spliceosomal RNA (ENSDLEG00000006973.1, ENSDLEG00000017276.1)
    22. Equus asinus asinus (donkey) U1 spliceosomal RNA (ENSEASG00005002753.1)
    23. Equus caballus (horse) U1 spliceosomal RNA (ENSECAG00000028137.1, ENSECAG00000036574.1, ENSECAG00000040610.1)
    24. Felis catus (domestic cat) U1 spliceosomal RNA (multiple genes)
    25. Fukomys damarensis (Damara mole rat) U1 spliceosomal RNA (ENSFDAG00000004070.1)
    26. Gorilla gorilla gorilla U1 spliceosomal RNA (multiple genes)
    27. Heterocephalus glaber (naked mole-rat) U1 spliceosomal RNA (multiple genes)
    28. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) U1 spliceosomal RNA (ENSSTOG00000019604.1, ENSSTOG00000021984.1)
    29. Loxodonta africana U1 spliceosomal RNA (multiple genes)
    30. Lynx canadensis (Canada lynx) U1 spliceosomal RNA (multiple genes)
    31. Macaca fascicularis U1 spliceosomal RNA (multiple genes)
    32. Macaca mulatta U1 spliceosomal RNA (multiple genes)
    33. Macaca nemestrina (Pig-tailed macaque) U1 spliceosomal RNA (multiple genes)
    34. Mandrillus leucophaeus U1 spliceosomal RNA (multiple genes)
    35. Marmota marmota marmota (Alpine marmot) U1 spliceosomal RNA (ENSMMMG00000020270.1)
    36. Marmota monax non-coding RNA
    37. Microcebus murinus U1 spliceosomal RNA (ENSMICG00000043877.1)
    38. Monodon monoceros (narwhal) U1 spliceosomal RNA (ENSMMNG00015017597.1)
    39. Moschus moschiferus (Siberian musk deer) U1 spliceosomal RNA (multiple genes)
    40. Mustela putorius furo (Domestic ferret) U1 spliceosomal RNA (ENSMPUG00000021209.1, ENSMPUG00000022126.1, ENSMPUG00000023279.1)
    41. Neovison vison U1 spliceosomal RNA (ENSNVIG00000002890.1, ENSNVIG00000024220.1)
    42. Nomascus leucogenys U1 spliceosomal RNA (multiple genes)
    43. Otolemur garnettii U1 spliceosomal RNA (multiple genes)
    44. Ovis aries U1 spliceosomal RNA (multiple genes)
    45. Pan paniscus U1 spliceosomal RNA (ENSPPAG00000011577.1, ENSPPAG00000018041.1, ENSPPAG00000023642.1)
    46. Panthera leo U1 spliceosomal RNA (ENSPLOG00000001505.1, ENSPLOG00000001511.1)
    47. Panthera pardus U1 spliceosomal RNA (ENSPPRG00000018997.1, ENSPPRG00000019011.1)
    48. Panthera tigris altaica (Tiger) U1 spliceosomal RNA (ENSPTIG00000000590.1)
    49. Pan troglodytes (chimpanzee) U1 spliceosomal RNA (multiple genes)
    50. Papio anubis (Olive baboon) U1 spliceosomal RNA (multiple genes)
    51. Phocoena sinus U1 spliceosomal RNA (multiple genes)
    52. Physeter catodon U1 spliceosomal RNA (ENSPCTG00005009051.1, ENSPCTG00005011799.1)
    53. Piliocolobus tephrosceles U1 spliceosomal RNA (ENSPTEG00000012632.1, ENSPTEG00000032565.1, ENSPTEG00000032672.1, ENSPTEG00000037233.1)
    54. Pongo abelii U1 spliceosomal RNA (multiple genes)
    55. Procavia capensis U1 spliceosomal RNA (ENSPCAG00000019511.1, ENSPCAG00000019625.1, ENSPCAG00000019864.1, ENSPCAG00000019883.1)
    56. Prolemur simus (greater bamboo lemur) U1 spliceosomal RNA (ENSPSMG00000003843.1, ENSPSMG00000003851.1, ENSPSMG00000013079.1, ENSPSMG00000013081.1)
    57. Propithecus coquereli U1 spliceosomal RNA (ENSPCOG00000000552.1, ENSPCOG00000000570.1)
    58. Rhinopithecus bieti (Black snub-nosed monkey) U1 spliceosomal RNA (multiple genes)
    59. Rhinopithecus roxellana U1 spliceosomal RNA (ENSRROG00000000361.1, ENSRROG00000000465.1, ENSRROG00000018435.1)
    60. Saimiri boliviensis boliviensis U1 spliceosomal RNA (ENSSBOG00000006203.1)
    61. Sciurus vulgaris (Eurasian red squirrel) U1 spliceosomal RNA (ENSSVLG00005013784.1)
    62. Spermophilus dauricus U1 spliceosomal RNA (ENSSDAG00000020188.1, ENSSDAG00000024107.1)
    63. Suricata suricatta (meerkat) U1 spliceosomal RNA (ENSSSUG00005011116.1, ENSSSUG00005011151.1, ENSSSUG00005011164.1)
    64. Sus scrofa U1 spliceosomal RNA (multiple genes)
    65. Theropithecus gelada (gelada) U1 spliceosomal RNA (multiple genes)
    66. Tupaia belangeri (northern tree shrew) U1 spliceosomal RNA (ENSTBEG00000019049.1, ENSTBEG00000019220.1, ENSTBEG00000019257.1)
    67. Tupaia chinensis U1 spliceosomal RNA
    68. Tursiops truncatus U1 spliceosomal RNA (ENSTTRG00000022529.1, ENSTTRG00000023397.1, ENSTTRG00000024126.1)
    69. Ursus americanus (American black bear) U1 spliceosomal RNA (ENSUAMG00000003401.1, ENSUAMG00000009888.1, ENSUAMG00000028008.1)
    70. Ursus maritimus U1 spliceosomal RNA (ENSUMAG00000010408.1, ENSUMAG00000022763.1)
    71. Ursus thibetanus thibetanus (Asiatic black bear) U1 spliceosomal RNA (ENSUTTG00000021205.1)
    72. Vicugna pacos U1 spliceosomal RNA (ENSVPAG00000015642.1, ENSVPAG00000017220.1)
    73. Vulpes vulpes U1 spliceosomal RNA (ENSVVUG00000029956.1)
    74. Zalophus californianus U1 spliceosomal RNA (multiple genes)
    2D structure New