Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-3474 URS00003256E0_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-3474: Mmu-mir-3474, a microRNA, was found to be downregulated in response to HG stimulation [PMC7667287]. It was one of the five miRNAs that showed specific alterations in expression levels [PMC7667287]. A total of 368 potential target genes were identified for mmu-mir-3474 [PMC7667287]. Mmu-mir-3474 was predicted to be part of the mmu_circRNA_21040 related network, along with 14 other target miRNAs and 36 genes [PMC9574125]. Mmu-mir-3474 was also found to be related to DARPP-32, along with other microRNAs such as mmu-miR-6240 and mmu-miR-330-3p.2 [PMC10132208]. The expression levels of mmu-mir-3474 were measured using TaqMan MicroRNA Assays [PMC8007565].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGGGAGGAGACGUGGAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications