Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila yakuba tRNA-Leu (TAA) (tRNA-Leu-TAA-2-1, tRNA-Leu-TAA-2-2) secondary structure diagram

Drosophila yakuba tRNA-Leu (TAA) (tRNA-Leu-TAA-2-1, tRNA-Leu-TAA-2-2) URS000032012B_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCAGGUUGGCCGAGCGGUCUAAGGCGCCAGAUUUAAGCUCUGGUUCUCGUGAGAGAGCGUGGGUUCGAACCCCACACCUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Drosophila biarmipes (Fruit fly) transfer RNA leucine (anticodon UAA)
  2. Drosophila elegans (Fruit fly) tRNA-Leu
  3. Drosophila erecta tRNA-Leu (TAA) (tRNA-Leu-TAA-1-1)
  4. Drosophila eugracilis (Fruit fly) tRNA-Leu
  5. Drosophila ficusphila (Fruit fly) tRNA-Leu
  6. Drosophila gunungcola (Fruit fly) transfer RNA leucine (anticodon UAA)
  7. Drosophila kikkawai (Fruit fly) tRNA-Leu
  8. Drosophila mauritiana (Fruit fly) tRNA-Leu
  9. Drosophila melanogaster transfer RNA:Leucine-TAA 1-1 (Dmel_CR31506)
  10. Drosophila rhopaloa (Fruit fly) tRNA-Leu
  11. Drosophila santomea (Fruit fly) tRNA-Leu
  12. Drosophila sechellia tRNA-Leu (TAA) (tRNA-Leu-TAA-1-1)
  13. Drosophila simulans tRNA-Leu (TAA) (tRNA-Leu-TAA-1-1)
  14. Drosophila subpulchrella (Fruit fly) tRNA-Leu
  15. Drosophila suzukii (Fruit fly) tRNA-Leu
  16. Drosophila takahashii (Fruit fly) tRNA-Leu
  17. Drosophila teissieri (Fruit fly) tRNA-Leu
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications