Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548ai URS000031D186_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548ai: Hsa-mir-548ai is a microRNA that has been found to be up-regulated in breast cancer compared to normal tissues [PMC8004706]. It is one of the miRNAs that are co-expressed with heat shock proteins (HSPs) and are associated with poor prognosis in breast cancer [PMC8004706]. Hsa-mir-548ai is also part of a miRNA network that is up-regulated in poor prognosis and is implicated in the cell cycle [PMC8004706]. It shares a critical seed sequence with hsa-miR-548ba [PMC8501715]. Hsa-mir-548ai has been found to be down-regulated in breast cancer, along with several other miRNAs, including hsa-miR-125b-5p and hsa-miR-145-5p [PMC5820911]. Hsa-mir-548ai has also been studied in relation to gene-gene interactions and its role in predicting susceptibility and treatment response in gallbladder cancer patients [PMC5223017]. Overall, hsa-mir-548ai appears to play a role in various biological processes and disease conditions [PMC8004706, PMC8501715, PMC5820911, PMC5223017].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGGUAAUUGCAGUUUUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications