Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-211-5p URS00003138EF_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUUUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-211
  2. Canis lupus familiaris (dog) cfa-miR-211
  3. Cavia porcellus cpo-miR-211-5p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-211
  5. Dasypus novemcinctus dno-miR-211-5p
  6. Equus caballus (horse) eca-miR-211
  7. Macaca mulatta (Rhesus monkey) mml-miR-211
  8. Microcebus murinus (gray mouse lemur) mmr-miR-211
  9. Mus musculus (house mouse) mmu-miR-211-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-211-5p
  11. Rattus norvegicus rno-miR-211-5p