v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-211 URS00003138EF_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCCCUUUGUCAUCCUUUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-211
  2. Canis lupus familiaris (dog) cfa-miR-211
  3. Cavia porcellus cpo-miR-211-5p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-211
  5. Dasypus novemcinctus dno-miR-211-5p
  6. Equus caballus (horse) eca-miR-211
  7. Macaca mulatta (Rhesus monkey) mml-miR-211
  8. Mus musculus (house mouse) mmu-miR-211-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-211-5p
  10. Pteropus alecto (black flying fox) pal-miR-211-5p
  11. Rattus norvegicus rno-miR-211-5p