Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4324 URS000030F801_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4324: Hsa-mir-4324 is a microRNA that has been studied in relation to bladder cancer and triple-negative breast cancer (TNBC) [PMC7380276] [PMC6031086] [PMC6357448] [PMC9952540]. In bladder cancer, hsa-mir-4324, along with eight other microRNAs, provides prognostic and predictive value for patients with urothelial carcinoma of the bladder [PMC7380276]. Another study found that hsa-mir-4324 is one of the microRNAs that are downregulated in bladder cancer [PMC6031086]. In TNBC, reduced expression of hsa-mir-4324 was found to correlate with low PTEN expression, indicating a more aggressive form of the disease [PMC6357448]. Additionally, hsa-mir-4324 was identified as one of the miRNAs that positively correlated with PTEN-deficiency in TNBC [PMC6357448]. The expression levels of hsa-mir-4324 were also found to correlate positively with PTEN-loss in bladder cancer [PMC6357448]. Furthermore, a study discovered that hsa-mir-4324 is one of the downregulated miRNAs that regulate disease-associated genes in a network analysis [PMC9952540]. Overall, these findings suggest that hsa-mir-4324 may play a role in the development and progression of bladder cancer and TNBC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGAGACCCUAACCUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications