Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster bantam stem-loop (dme-bantam) secondary structure diagram

Drosophila melanogaster bantam stem-loop (dme-bantam) URS00002F21DA_7227

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (ENA, RefSeq, FlyBase, Rfam, miRBase). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (bantam, RF00727). Drosophila melanogaster bantam stem-loop (dme-bantam) sequence is a product of bantam precurso, bantam precursor, ban precursor RNA, mir-ban, mir-ban precursor RNA, FBgn0262451, ban precursor RN, dme-bantam precursor, bantam genes. Found in the Drosophila melanogaster reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUUUGACUACGAAACCGGUUUUCGAUUUGGUUUGACUGUUUUUCAUACAAGUGAGAUCAUUUUGAAAGCUGAUUUUGUCAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 7 other species

    1. Drosophila busckii microRNA bantam
    2. Drosophila erecta bantam stem-loop (der-bantam)
    3. Drosophila ficusphila microRNA bantam
    4. Drosophila sechellia bantam stem-loop (dse-bantam)
    5. Drosophila simulans bantam stem-loop (dsi-bantam)
    6. Drosophila willistoni bantam stem-loop (dwi-bantam)
    7. Drosophila yakuba bantam stem-loop (dya-bantam)
    2D structure Publications