Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, FlyBase, RefSeq, miRBase). Described in 21 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (bantam, RF00727). Drosophila melanogaster bantam stem-loop (dme-bantam) sequence is a product of bantam precursor, bantam, dme-bantam precursor, ban precursor RN, mir-ban, bantam precurso, mir-ban precursor RNA, ban precursor RNA, FBgn0262451 genes.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUUGACUACGAAACCGGUUUUCGAUUUGGUUUGACUGUUUUUCAUACAAGUGAGAUCAUUUUGAAAGCUGAUUUUGUCAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.