Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster bantam stem-loop (dme-bantam) secondary structure diagram

Drosophila melanogaster bantam stem-loop (dme-bantam) URS00002F21DA_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUUGACUACGAAACCGGUUUUCGAUUUGGUUUGACUGUUUUUCAUACAAGUGAGAUCAUUUUGAAAGCUGAUUUUGUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Drosophila albomicans bantam microRNA precursor family
  2. Drosophila busckii bantam microRNA precursor family
  3. Drosophila erecta bantam stem-loop (der-bantam)
  4. Drosophila ficusphila bantam microRNA precursor family
  5. Drosophila gunungcola bantam microRNA precursor family
  6. Drosophila rhopaloa bantam microRNA precursor family
  7. Drosophila sechellia bantam stem-loop (dse-bantam)
  8. Drosophila simulans bantam stem-loop (dsi-bantam)
  9. Drosophila willistoni bantam stem-loop (dwi-bantam)
  10. Drosophila yakuba bantam stem-loop (dya-bantam)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications