v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila willistoni bantam stem-loop (dwi-bantam) secondary structure diagram

Drosophila willistoni bantam stem-loop (dwi-bantam) URS00002F21DA_7260

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUUGACUACGAAACCGGUUUUCGAUUUGGUUUGACUGUUUUUCAUACAAGUGAGAUCAUUUUGAAAGCUGAUUUUGUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Drosophila busckii bantam microRNA precursor family
  2. Drosophila erecta bantam stem-loop (der-bantam)
  3. Drosophila ficusphila bantam microRNA precursor family
  4. Drosophila melanogaster bantam stem-loop (dme-bantam)
  5. Drosophila sechellia bantam stem-loop (dse-bantam)
  6. Drosophila simulans bantam stem-loop (dsi-bantam)
  7. Drosophila yakuba bantam stem-loop (dya-bantam)
 2D structure Publications