Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus sp. FSL K6-8391 tRNA-Ala secondary structure diagram

Bacillus sp. FSL K6-8391 tRNA-Ala URS00002F180C_2975323

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGCCUUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCAGCGGUUCGAUCCCGCUAGGCUCCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,083 other species

  1. Acholeplasmatales bacterium tRNA-Ala
  2. Acinetobacter baumannii tRNA-Ala(tgc)
  3. Aeribacillus composti tRNA-Ala
  4. Aeribacillus pallidus tRNA-Ala
  5. Aeribacillus sp. FSL K6-1121 tRNA-Ala
  6. Aeribacillus sp. FSL K6-1305 tRNA-Ala
  7. Aeribacillus sp. FSL k6-2211 tRNA-Ala
  8. Aeribacillus sp. FSL K6-2833 tRNA-Ala
  9. Aeribacillus sp. FSL K6-2848 tRNA-Ala
  10. Aeribacillus sp. FSL K6-3256 tRNA-Ala
  11. Aeribacillus sp. FSL K6-8210 tRNA-Ala
  12. Aeribacillus sp. FSL K6-8394 tRNA-Ala
  13. Aeribacillus sp. FSL M8-0235 tRNA-Ala
  14. Aeribacillus sp. FSL M8-0254 tRNA-Ala
  15. Aeribacillus sp. FSL W8-0870 tRNA-Ala
  16. Aeromicrobium ponti tRNA-Ala
  17. Agathobacter ruminis tRNA-Ala
  18. Aliibacillus thermotolerans tRNA-Ala
  19. Alkalibacillus flavidus tRNA-Ala
  20. Alkalibacillus salilacus tRNA-Ala
  21. Alkalibacillus silvisoli tRNA-Ala
  22. Alkalibacillus sp. S2W tRNA-Ala
  23. Alkalicoccobacillus gibsonii tRNA-Ala
  24. Alkalicoccus chagannorensis tRNA-Ala(tgc)
  25. Alkalicoccus halolimnae tRNA-Ala
  26. Alkalicoccus saliphilus tRNA-Ala
  27. Alkalihalobacillus alcalophilus tRNA-Ala
  28. Alkalihalobacillus sp. 1P02AB tRNA-Ala
  29. Shouchella hunanensis tRNA-Ala
  30. Alkalihalobacillus sp. LMS6 tRNA-Ala
  31. Allobacillus halotolerans tRNA-Ala
  32. Allobacillus sp. GCM10007489 tRNA-Ala
  33. Allobacillus sp. GCM10007490 tRNA-Ala
  34. Allobacillus sp. GCM10007491 tRNA-Ala
  35. Allobacillus sp. SKP2-8 tRNA-Ala
  36. Allobacillus salarius tRNA-Ala
  37. Allobacillus saliphilus tRNA-Ala
  38. Alphaproteobacteria bacterium tRNA-Ala
  39. Alteribacillus sp. JSM 102045 tRNA-Ala
  40. Aneurinibacillus aneurinilyticus tRNA-Ala
  41. [Anoxybacillus] calidus tRNA-Ala
  42. Aquibacillus albus tRNA-Ala
  43. Aquibacillus koreensis tRNA-Ala
  44. Aquibacillus rhizosphaerae tRNA-Ala
  45. Aquibacillus salsiterrae tRNA-Ala
  46. Arthrobacter sp. NPDC057009 tRNA-Ala
  47. Pradoshia eiseniae tRNA-Ala
  48. Bacillaceae bacterium JMAK1 tRNA-Ala
  49. Bacillaceae bacterium Marseille-Q3522 tRNA-Ala
  50. Fervidibacillus albus tRNA-Ala
  51. Fervidibacillus halotolerans tRNA-Ala
  52. Mangrovibacillus cuniculi tRNA-Ala
  53. Bacillaceae bacterium SAOS 7 tRNA-Ala
  54. Bacillaceae bacterium SAS-127 tRNA-Ala
  55. Radiobacillus deserti tRNA-Ala
  56. Bacillaceae bacterium tRNA-Ala
  57. Bacillales bacterium tRNA-Ala
  58. Bacilli bacterium tRNA-Ala
  59. Bacillota bacterium tRNA-Ala
  60. Bacillus aerius tRNA-Ala
  61. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Ala
  62. Aeribacillus alveayuensis tRNA-Ala
  63. Bacillus amyloliquefaciens CC178 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  64. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  65. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Ala
  66. Bacillus amyloliquefaciens IT-45 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  67. Bacillus amyloliquefaciens KHG19 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  68. Bacillus amyloliquefaciens LFB112 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  69. Bacillus amyloliquefaciens LL3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  70. Bacillus amyloliquefaciens TA208 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  71. Bacillus amyloliquefaciens tRNA-Ala
  72. Bacillus amyloliquefaciens UASWS BA1 tRNA-Ala
  73. Bacillus amyloliquefaciens UMAF6614 tRNA-Ala
  74. Bacillus amyloliquefaciens UMAF6639 tRNA-Ala
  75. Bacillus amyloliquefaciens XH7 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  76. Bacillus velezensis YAU B9601-Y2 tRNA-Ala
  77. Pseudobacillus badius tRNA-Ala
  78. Bacillus cabrialesii subsp. cabrialesii tRNA-Ala
  79. Bacillus cabrialesii subsp. tritici tRNA-Ala
  80. Bacillus cabrialesii tRNA-Ala
  81. Mesobacillus campisalis tRNA-Ala
  82. Bacillus canaveralius tRNA-Ala
  83. Bacillus carboniphilus tRNA-Ala
  84. Bacillus cereus tRNA-Ala
  85. Bacillus changyiensis tRNA-Ala
  86. Niallia circulans tRNA-Ala(tgc)
  87. Heyndrickxia coagulans P38 tRNA-Ala
  88. Bacillus coahuilensis m2-6 tRNA-Ala
  89. Bacillus coahuilensis p1.1.43 tRNA-Ala
  90. Alkalicoccus daliensis tRNA_Ala_TGC
  91. [Bacillus] enclensis tRNA_Ala_TGC
  92. Niallia endozanthoxylica tRNA-Ala
  93. Bacillus firmis tRNA-Ala
  94. Cytobacillus firmus DS1 tRNA-Ala
  95. Bacillus freudenreichii tRNA-Ala(tgc)
  96. Lederbergia galactosidilytica tRNA-Ala
  97. Bacillus glycinifermentans tRNA-Ala
  98. Bacillus haikouensis tRNA-Ala
  99. Bacillus halotolerans tRNA-Ala
  100. Bacillus haynesii tRNA-Ala
  101. Bacillus inaquosorum tRNA-Ala(tgc)
  102. Bacillus infantis NRRL B-14911 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  103. Bacillus infantis tRNA-Ala
  104. Shouchella lehensis tRNA-Ala
  105. Bacillus licheniformis CG-B52 tRNA-Ala
  106. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  107. Bacillus licheniformis LMG 6934 tRNA-Ala
  108. Bacillus licheniformis tRNA-Ala(tgc)
  109. Bacillus licheniformis WX-02 tRNA-Ala
  110. Bacillus lumedeiriae tRNA-Ala
  111. Rossellomorea marisflavi tRNA-Ala
  112. Priestia megaterium tRNA-Ala
  113. Bacillus methanolicus MGA3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  114. Bacillus methanolicus PB1 tRNA-Ala
  115. Bacillus methanolicus tRNA-Ala
  116. Bacillus mojavensis tRNA-Ala
  117. Bacillus nakamurai tRNA-Ala
  118. Neobacillus notoginsengisoli tRNA-Ala
  119. Bacillus obstructivus tRNA-Ala
  120. Cytobacillus oceanisediminis 2691 tRNA-Ala
  121. Halalkalibacterium halodurans tRNA-Ala
  122. Bacillus oleivorans tRNA-Ala
  123. Bacillus paralicheniformis ATCC 9945a tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  124. Bacillus paralicheniformis tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  125. Alkalihalobacillus pseudalcaliphilus tRNA-Ala
  126. Bacillus rugosus tRNA-Ala
  127. Bacillus safensis tRNA-Ala
  128. [Bacillus] selenitireducens MLS10 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  129. Bacillus seohaeanensis tRNA-Ala
  130. Bacillus shivajii tRNA-Ala
  131. Bacillus siamensis tRNA-Ala
  132. Bacillus smithii 7_3_47FAA tRNA-Ala
  133. Bacillus smithii tRNA-Ala
  134. Bacillus solimangrovi tRNA-Ala
  135. Bacillus songklensis tRNA-Ala
  136. Bacillus sonorensis L12 tRNA-Ala
  137. Bacillus sonorensis tRNA-Ala
  138. Bacillus sp. 1NLA3E tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  139. Bacillus sp. 1P02SD tRNA-Ala
  140. Bacillus sp. 1P10SD tRNA-Ala
  141. Bacillus sp. 1s-1 tRNA-Ala
  142. Bacillus sp. 2211 tRNA-Ala
  143. Bacillus sp. 275 tRNA-Ala
  144. Bacillus sp. 2_A_57_CT2 tRNA-Ala
  145. Bacillus sp. 31 tRNA-Ala
  146. Siminovitchia acidinfaciens tRNA-Ala
  147. Bacillus sp. 349Y tRNA-Ala
  148. Bacillus sp. 5001 tRNA-Ala
  149. Bacillus sp. 5B6 tRNA-Ala
  150. Bacillus sp. 7520-S tRNA-Ala
  151. Bacillus sp. 7586-K tRNA-Ala
  152. Bacillus sp. 7894-2 tRNA-Ala
  153. Bacillus sp. 7D3 tRNA-Ala
  154. Bacillus sp. A053 tRNA-Ala
  155. Bacillus sp. A116_S68 tRNA-Ala
  156. Bacillus sp. A1 tRNA-Ala
  157. Bacillus sp. A301a_S52 tRNA-Ala
  158. Bacillus sp. AAVF1 tRNA-Ala
  159. Bacillus sp. AFS006103 tRNA-Ala
  160. Bacillus sp. AFS015802 tRNA-Ala
  161. Bacillus sp. AFS031507 tRNA-Ala
  162. Bacillus sp. AFS040349 tRNA-Ala
  163. Bacillus sp. AG1 tRNA-Ala
  164. Bacillus sp. AG4(2022) (2022) tRNA-Ala
  165. Bacillus sp. AM1(2019) tRNA-Ala
  166. Bacillus sp. ANT_WA51 tRNA-Ala
  167. Bacillus sp. B1(2022) tRNA-Ala
  168. Bacillus sp. B18(2022) tRNA-Ala
  169. Bacillus sp. B19-2 tRNA-Ala
  170. Bacillus sp. B2(2022) tRNA-Ala
  171. Bacillus sp. B28 tRNA-Ala
  172. Bacillus sp. B8(2022) tRNA-Ala
  173. Bacillus sp. BAC tRNA-Ala
  174. Bacillus sp. BC1-43 tRNA-Ala
  175. Bacillus sp. BH072 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  176. Bacillus sp. BHET2 tRNA-Ala
  177. Bacillus sp. B-jedd tRNA-Ala
  178. Bacillus sp. BT1B_CT2 tRNA-Ala
  179. Bacillus sp. Bvel1 tRNA-Ala
  180. Bacillus sp. C10(2022) tRNA-Ala
  181. Bacillus sp. C11(2022) tRNA-Ala
  182. Bacillus sp. C1-1 tRNA-Ala
  183. Bacillus sp. C2(2022) tRNA-Ala
  184. Bacillus sp. C28GYM-DRY-1 tRNA-Ala
  185. Bacillus sp. C3(2022) tRNA-Ala
  186. Bacillus sp. C37plca tRNA-Ala
  187. Bacillus sp. C5(2022) tRNA-Ala
  188. Bacillus sp. CCNWLCWHY013 tRNA-Ala
  189. Bacillus sp. CH30_1T tRNA-Ala
  190. Bacillus sp. CMAA 1185 tRNA-Ala
  191. Bacillus sp. CMF12 tRNA-Ala
  192. Bacillus sp. CPSM8 tRNA-Ala
  193. Bacillus aerolatus tRNA-Ala
  194. Bacillus sp. D12 tRNA-Ala
  195. Bacillus sp. DM2 tRNA-Ala
  196. Bacillus sp. DNRA2 tRNA-Ala
  197. Metabacillus sediminilitoris tRNA-Ala
  198. Bacillus sp. DSM 27956 tRNA-Ala
  199. Bacillus sp. EB106-08-02-XG196 tRNA-Ala
  200. Bacillus sp. EKM213B tRNA-Ala
  201. Bacillus sp. EKM417B tRNA-Ala
  202. Bacillus sp. EKM420B tRNA-Ala
  203. Bacillus sp. es.034 tRNA-Ala
  204. Bacillus sp. EU52 tRNA-Ala
  205. Bacillus sp. EU55 tRNA-Ala
  206. Bacillus sp. EU62 tRNA-Ala
  207. Bacillus sp. EU63 tRNA-Ala
  208. Bacillus sp. FJAT-14266 tRNA-Ala
  209. Bacillus sp. FJAT-18017 tRNA-Ala
  210. Bacillus sp. FJAT-27225 tRNA-Ala
  211. Bacillus sp. FJAT-27231 tRNA-Ala
  212. Bacillus sp. FJAT-27445 tRNA-Ala
  213. Bacillus sp. FJAT-27916 tRNA-Ala
  214. Bacillus sp. FJAT-27986 tRNA-Ala
  215. Bacillus sp. FJAT-29953 tRNA-Ala
  216. Bacillus sp. FJAT-49711 tRNA-Ala
  217. Bacillus sp. FJAT-49736 tRNA-Ala
  218. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Ala
  219. Bacillus sp. FMQ74 tRNA-Ala
  220. Bacillus sp. FSL E2-0174 tRNA-Ala
  221. Bacillus sp. FSL H8-0515 tRNA-Ala
  222. Bacillus sp. FSL K6-0036 tRNA-Ala
  223. Bacillus sp. FSL K6-0047 tRNA-Ala
  224. Bacillus sp. FSL K6-0138 tRNA-Ala
  225. Bacillus sp. FSL K6-0250 tRNA-Ala
  226. Bacillus sp. FSL K6-0255 tRNA-Ala
  227. Bacillus sp. FSL K6-0764 tRNA-Ala
  228. Bacillus sp. FSL K6-0947 tRNA-Ala
  229. Bacillus sp. FSL K6-0972 tRNA-Ala
  230. Bacillus sp. FSL K6-0993 tRNA-Ala
  231. Bacillus sp. FSL K6-0998 tRNA-Ala
  232. Bacillus sp. FSL K6-1003 tRNA-Ala
  233. Bacillus sp. FSL K6-1005 tRNA-Ala
  234. Bacillus sp. FSL K6-1012 tRNA-Ala
  235. Bacillus sp. FSL K6-1109 tRNA-Ala
  236. Bacillus sp. FSL K6-1234 tRNA-Ala
  237. Bacillus sp. FSL K6-1284 tRNA-Ala
  238. Bacillus sp. FSL K6-1366 tRNA-Ala
  239. Bacillus sp. FSL K6-1560 tRNA-Ala
  240. Bacillus sp. FSL K6-2819 tRNA-Ala
  241. Bacillus sp. FSL K6-2861 tRNA-Ala
  242. Bacillus sp. FSL K6-2865 tRNA-Ala
  243. Bacillus sp. FSL K6-3846 tRNA-Ala
  244. Bacillus sp. FSL K6-5915 tRNA-Ala
  245. Bacillus sp. FSL K6-6483 tRNA-Ala
  246. Bacillus sp. FSL K6-6540 tRNA-Ala
  247. Bacillus sp. FSL L8-0173 tRNA-Ala
  248. Bacillus sp. FSL L8-0186 tRNA-Ala
  249. Bacillus sp. FSL L8-0193 tRNA-Ala
  250. Bacillus sp. FSL L8-0222 tRNA-Ala
  251. Bacillus sp. FSL L8-0358 tRNA-Ala
  252. Bacillus sp. FSL L8-0528 tRNA-Ala
  253. Bacillus sp. FSL M7-0417 tRNA-Ala
  254. Bacillus sp. FSL M7-1004 tRNA-Ala
  255. Bacillus sp. FSL M8-0025 tRNA-Ala
  256. Bacillus sp. FSL M8-0052 tRNA-Ala
  257. Bacillus sp. FSL M8-0054 tRNA-Ala
  258. Bacillus sp. FSL M8-0071 tRNA-Ala
  259. Bacillus sp. FSL M8-0133 tRNA-Ala
  260. Bacillus sp. FSL M8-0168 tRNA-Ala
  261. Bacillus sp. FSL M8-0315 tRNA-Ala
  262. Bacillus sp. FSL M8-0359 tRNA-Ala
  263. Bacillus sp. FSL P2-0026 tRNA-Ala
  264. Bacillus sp. FSL P4-0290 tRNA-Ala
  265. Bacillus sp. FSL P4-0334 tRNA-Ala
  266. Bacillus sp. FSL R5-0394 tRNA-Ala
  267. Bacillus sp. FSL R5-0416 tRNA-Ala
  268. Bacillus sp. FSL R5-0418 tRNA-Ala
  269. Bacillus sp. FSL R5-0434 tRNA-Ala
  270. Bacillus sp. FSL R5-0443 tRNA-Ala
  271. Bacillus sp. FSL R5-0447 tRNA-Ala
  272. Bacillus sp. FSL R5-0523 tRNA-Ala
  273. Bacillus sp. FSL R5-0560 tRNA-Ala
  274. Bacillus sp. FSL R5-0576 tRNA-Ala
  275. Bacillus sp. FSL R5-0593 tRNA-Ala
  276. Bacillus sp. FSL R5-0603 tRNA-Ala
  277. Bacillus sp. FSL R7-0646 tRNA-Ala
  278. Bacillus sp. FSL R7-0685 tRNA-Ala
  279. Bacillus sp. FSL R7-0718 tRNA-Ala
  280. Bacillus sp. FSL W7-1092 tRNA-Ala
  281. Bacillus sp. FSL W7-1282 tRNA-Ala
  282. Bacillus sp. FSL W7-1321 tRNA-Ala
  283. Bacillus sp. FSL W7-1354 tRNA-Ala
  284. Bacillus sp. FSL W7-1360 tRNA-Ala
  285. Bacillus sp. FSL W8-0102 tRNA-Ala
  286. Bacillus sp. FSL W8-0116 tRNA-Ala
  287. Bacillus sp. FSL W8-0223 tRNA-Ala
  288. Bacillus sp. FSL W8-0445 tRNA-Ala
  289. Bacillus sp. FSL W8-0812 tRNA-Ala
  290. Bacillus sp. FSL W8-0848 tRNA-Ala
  291. Bacillus sp. FSL W8-0940 tRNA-Ala
  292. Bacillus sp. FSL W8-1122 tRNA-Ala
  293. Bacillus sp. FSL W8-1127 tRNA-Ala
  294. Bacillus sp. FSL W8-1202 tRNA-Ala
  295. Bacillus sp. FW1 tRNA-Ala
  296. Bacillus sp. GZB tRNA-Ala
  297. Bacillus sp. H15-1 tRNA-Ala
  298. Exobacillus caeni tRNA-Ala
  299. Bacillus sp. HNA3 tRNA-Ala
  300. Bacillus sp. HNG tRNA-Ala
  301. Bacillus sp. HSf4 tRNA-Ala
  302. Bacillus sp. ICE1 tRNA-Ala
  303. Bacillus sp. IG2 tRNA-Ala
  304. Bacillus sp. IG6 tRNA-Ala
  305. Bacillus sp. (in: firmicutes) tRNA-Ala
  306. Bacillus sp. IS1 tRNA-Ala
  307. Bacillus sp. ISL-40 tRNA-Ala
  308. Bacillus sp. ISL-46 tRNA-Ala
  309. Bacillus sp. ISL-47 tRNA-Ala
  310. Bacillus sp. ISL-77 tRNA-Ala
  311. Bacillus sp. ISL-7 tRNA-Ala
  312. Bacillus sp. IT-13CA1 tRNA-Ala
  313. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Ala
  314. Bacillus spizizenii str. W23 tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  315. Bacillus spizizenii tRNA-Ala(tgc)
  316. Bacillus spizizenii tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  317. Bacillus spizizenii TU-B-10 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  318. Bacillus sp. J14TS2 tRNA-Ala
  319. Bacillus sp. J41TS8 tRNA-Ala
  320. Bacillus sp. J5TS4 tRNA-Ala
  321. Bacillus sp. JHAA tRNA-Ala
  322. Sutcliffiella rhizosphaerae tRNA-Ala
  323. Bacillus sp. JJ1533 tRNA-Ala
  324. Bacillus sp. JJ1562 tRNA-Ala
  325. Bacillus sp. JNUCC-21 tRNA-Ala
  326. Bacillus sp. JNUCC-22 tRNA-Ala
  327. Bacillus sp. JRC01 tRNA-Ala
  328. Bacillus sp. JS tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  329. Bacillus sp. KBS0812 tRNA-Ala
  330. Bacillus sp. KH172YL63 tRNA-Ala
  331. Bacillus sp. KICET-1 tRNA-Ala
  332. Bacillus sp. KICET-3 tRNA-Ala
  333. Alteribacter keqinensis tRNA-Ala
  334. Bacillus sp. L381 tRNA-Ala
  335. Bacillus sp. LB7 tRNA-Ala
  336. Bacillus sp. Leaf406 tRNA-Ala
  337. Neobacillus massiliamazoniensis tRNA-Ala
  338. Bacillus sp. LJBS06 tRNA-Ala
  339. Bacillus sp. LJBS17 tRNA-Ala
  340. Bacillus sp. LJBV19 tRNA-Ala
  341. Bacillus sp. LK7 tRNA-Ala
  342. Bacillus sp. LM 4-2 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  343. Bacillus sp. LMB3902 tRNA-Ala
  344. Bacillus sp. LUNF1 tRNA-Ala
  345. Bacillus sp. LYLB4 tRNA-Ala
  346. Bacillus velezensis tRNA-Ala
  347. Paenalkalicoccus suaedae tRNA-Ala
  348. Bacillus sp. Man122 tRNA-Ala
  349. Bacillus sp. MBGLi97 tRNA-Ala
  350. Bacillus sp. MD-5 tRNA-Ala
  351. Bacillus sp. MKU004 tRNA-Ala
  352. Bacillus sp. MRMR6 tRNA-Ala
  353. Bacillus sp. MT(2024) tRNA-Ala
  354. Bacillus sp. MT tRNA-Ala
  355. Bacillus sp. N13C7 tRNA-Ala
  356. Cytobacillus sp. NCCP-133 tRNA-Ala
  357. Bacillus sp. NEAU-16 tRNA-Ala
  358. Bacillus sp. NEAU-242-2 tRNA-Ala
  359. Bacillus sp. NIO_002 tRNA-Ala
  360. Bacillus sp. NTK034 tRNA-Ala
  361. Bacillus sp. NTK074B tRNA-Ala
  362. Bacillus sp. OAE578 tRNA-Ala
  363. Bacillus sp. OG2 tRNA-Ala
  364. Bacillus spongiae tRNA-Ala
  365. Bacillus sp. PAMC26543 tRNA-Ala
  366. Bacillus sp. PAMC28748 tRNA-Ala
  367. Bacillus sp. Pc3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  368. Bacillus sp. PK3_68 tRNA-Ala
  369. Bacillus sp. PM8313 tRNA-Ala
  370. Bacillus sp. PS108 tRNA-Ala
  371. Bacillus sp. PS11(2022) tRNA-Ala
  372. Bacillus sp. PS18 tRNA-Ala
  373. Bacillus sp. PS194 tRNA-Ala
  374. Bacillus sp. PS196 tRNA-Ala
  375. Bacillus sp. PS20 tRNA-Ala
  376. Bacillus sp. PS210 tRNA-Ala
  377. Bacillus sp. PS217 tRNA-Ala
  378. Bacillus sp. PS237 tRNA-Ala
  379. Bacillus sp. PS65 tRNA-Ala
  380. Bacillus sp. PS68 tRNA-Ala
  381. Bacillus sp. PS93 tRNA-Ala
  382. Bacillus sp. PS95 tRNA-Ala
  383. Bacillus sp. R45 tRNA-Ala
  384. Bacillus sp. RHF6 tRNA-Ala
  385. Bacillus sp. RHFS10 tRNA-Ala
  386. Bacillus sp. RHFS18 tRNA-Ala
  387. Bacillus ayatagriensis Bacillus sp. RMG-6 tRNA-Ala
  388. Bacillus sp. RO1 tRNA-Ala
  389. Bacillus sp. Ru63 tRNA-Ala
  390. Bacillus sp. S10C12M tRNA-Ala
  391. Bacillus sp. S17B2 tRNA-Ala
  392. Bacillus sp. S20C3 tRNA-Ala
  393. Bacillus sp. S3 tRNA-Ala
  394. Bacillus sp. SA1-12 tRNA-Ala
  395. Bacillus norwichensis tRNA-Ala
  396. Bacillus sp. SAJ1 tRNA-Ala
  397. Bacillus sp. SB49 tRNA-Ala
  398. Rossellomorea sedimentorum Bacillus sp. SCS-153A tRNA-Ala
  399. Bacillus sp. SD088 tRNA-Ala
  400. Bacillus sp. SDLI1 tRNA-Ala
  401. Bacillus sp. SG20032 tRNA-Ala
  402. Bacillus sp. SG20033 tRNA-Ala
  403. Bacillus sp. SIMBA_006 tRNA-Ala
  404. Bacillus sp. SIMBA_008 tRNA-Ala
  405. Bacillus sp. SIMBA_026 tRNA-Ala
  406. Bacillus sp. SIMBA_031 tRNA-Ala
  407. Bacillus sp. SIMBA_033 tRNA-Ala
  408. Bacillus sp. SKDU12 tRNA-Ala
  409. Bacillus salacetis tRNA-Ala
  410. Bacillus sp. SL112 tRNA-Ala
  411. Bacillus sp. SLBN-46 tRNA-Ala
  412. Bacillus sp. SN1 tRNA-Ala
  413. Bacillus sp. SN32 tRNA-Ala
  414. Bacillus sp. SORGH_AS_0510 tRNA-Ala
  415. Paenibacillus sp. PL91 tRNA-Ala
  416. Bacillus paralicheniformis tRNA-Ala
  417. Bacillus sp. SW14 tRNA-Ala
  418. Bacillus sp. T17B1 tRNA-Ala
  419. Bacillus sp. T33-2 tRNA-Ala
  420. Bacillus sp. T9C1 tRNA-Ala
  421. Bacillus sp. THAF10 tRNA-Ala
  422. Bacillus sp. TS-2 tRNA-Ala
  423. Bacillus sp. TSA-4 tRNA-Ala
  424. Bacillus sp. UMB0728 tRNA-Ala
  425. Bacillus sp. UMB0899 tRNA-Ala
  426. Bacillus sp. V26 tRNA-Ala
  427. Bacillus sp. V3-13 tRNA-Ala
  428. Bacillus sp. V33-4 tRNA-Ala
  429. Bacillus sp. V3 tRNA-Ala
  430. Bacillus sp. VT-16-64 tRNA-Ala
  431. Bacillus sp. WR11 tRNA-Ala
  432. Bacillus sp. WR12 tRNA-Ala
  433. Bacillus sp. WR13 tRNA-Ala
  434. Bacillus sp. X1(2014) tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  435. Bacillus sp. X2(2017) tRNA-Ala
  436. Bacillus sp. XZ-5 tRNA-Ala
  437. Bacillus sp. YBsi01 tRNA-Ala
  438. Neobacillus piezotolerans tRNA-Ala
  439. Bacillus sp. YP1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  440. Alteribacter lacisalsi tRNA-Ala
  441. Bacillus sp. z60-10 tRNA-Ala
  442. Bacillus sp. z60-11 tRNA-Ala
  443. Bacillus sp. z60-18 tRNA-Ala
  444. Bacillus sp. ZCB01 tRNA-Ala
  445. Bacillus sp. ZHX3 tRNA-Ala
  446. Bacillus sp. ZY-1-1 tRNA-Ala
  447. Bacillus sp. ZZV12-4809 tRNA-Ala
  448. Bacillus stercoris tRNA-Ala
  449. Mesobacillus subterraneus tRNA-Ala
  450. Bacillus subtilis BEST7003 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  451. Bacillus subtilis BEST7613 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  452. Bacillus subtilis BSn5 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  453. Bacillus subtilis HJ5 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  454. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  455. Bacillus subtilis PY79 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  456. Bacillus subtilis QB928 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  457. Bacillus subtilis QH-1 tRNA-Ala
  458. Bacillus subtilis subsp. natto BEST195 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  459. Bacillus subtilis subsp. natto tRNA-Ala
  460. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  461. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 = DSM 10 tRNA-Ala
  462. Bacillus subtilis subsp. subtilis str. 168 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  463. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  464. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 9)
  465. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  466. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  467. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  468. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  469. Bacillus subtilis subsp. subtilis str. SMY tRNA-Ala
  470. Bacillus subtilis subsp. subtilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  471. Bacillus subtilis TO-A tRNA-Ala
  472. Bacillus subtilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 6)
  473. Bacillus subtilis XF-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  474. Bacillus swezeyi tRNA-Ala
  475. Bacillus taeanensis tRNA-Ala
  476. Bacillus tequilensis tRNA-Ala(tgc)
  477. Bacillus thuringiensis HD1002 tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1)
  478. Bacillus thuringiensis HD-789 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  479. Bacillus thuringiensis serovar israelensis tRNA-Ala(tgc)
  480. Bacillus thuringiensis serovar novosibirsk tRNA-Ala
  481. Bacillus thuringiensis tRNA-Ala
  482. Sutcliffiella tianshenii tRNA-Ala
  483. Bacillus timonensis tRNA-Ala
  484. Alkalihalobacillus trypoxylicola tRNA-Ala
  485. Alkalicoccus urumqiensis tRNA-Ala
  486. Bacillus vallismortis tRNA-Ala
  487. Bacillus velezensis AS43.3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  488. Bacillus velezensis CAU B946 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  489. Bacillus velezensis FZB42 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  490. Bacillus velezensis NAU-B3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  491. Bacillus velezensis NJN-6 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  492. Bacillus velezensis SQR9 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  493. Bacillus velezensis TrigoCor1448 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  494. Bacillus velezensis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  495. Bacillus velezensis UCMB5033 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  496. Bacillus velezensis UCMB5036 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  497. Bacillus velezensis UCMB5113 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  498. Bacillus velezensis YAU B9601-Y2 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  499. Rossellomorea vietnamensis tRNA-Ala
  500. Heyndrickxia vini tRNA-Ala
  501. Bacillus weihaiensis tRNA-Ala
  502. Pseudobacillus wudalianchiensis tRNA-Ala
  503. Bhargavaea beijingensis tRNA_Ala_TGC
  504. Bhargavaea cecembensis DSE10 tRNA-Ala
  505. Bhargavaea cecembensis tRNA-Ala
  506. Bhargavaea changchunensis tRNA-Ala
  507. Bhargavaea ullalensis tRNA-Ala
  508. Caldibacillus thermoamylovorans tRNA-Ala
  509. Caldifermentibacillus hisashii tRNA-Ala
  510. Candidatus Absconditabacterales bacterium tRNA-Ala
  511. Candidatus Erysipelatoclostridium merdavium tRNA-Ala
  512. Liberiplasma polymorphum Candidatus Izemoplasmataceae bacterium C05PYG tRNA-Ala
  513. Candidatus Izemoplasmataceae bacterium tRNA-Ala
  514. Chondromyces sp. tRNA-Ala
  515. Clostridium faecium tRNA-Ala
  516. Compostibacillus humi tRNA-Ala
  517. compost metagenome tRNA-Ala
  518. Coprobacillaceae bacterium CR2/5/TPMF4 tRNA-Ala
  519. Crossiella cryophila tRNA-Ala
  520. Cutibacterium acnes tRNA-Ala
  521. Cyanobacterium aponinum 0216 tRNA-Ala
  522. Cytobacillus firmus tRNA-Ala
  523. Cytobacillus horneckiae tRNA-Ala
  524. Cytobacillus kochii tRNA-Ala
  525. Cytobacillus oceanisediminis tRNA-Ala(tgc)
  526. Cytobacillus pseudoceanisediminis tRNA-Ala
  527. Cytobacillus purgationiresistens tRNA-Ala
  528. Cytobacillus sp. FSL H8-0458 tRNA-Ala
  529. Cytobacillus sp. FSL K6-0129 tRNA-Ala
  530. Cytobacillus sp. FSL K6-0265 tRNA-Ala
  531. Cytobacillus sp. FSL M8-0252 tRNA-Ala
  532. Cytobacillus sp. FSL R5-0377 tRNA-Ala
  533. Cytobacillus sp. FSL R5-0569 tRNA-Ala
  534. Cytobacillus sp. FSL R5-0596 tRNA-Ala
  535. Cytobacillus sp. FSL R7-0680 tRNA-Ala
  536. Cytobacillus sp. FSL R7-0696 tRNA-Ala
  537. Cytobacillus sp. FSL W7-1323 tRNA-Ala
  538. Cytobacillus sp. FSL W8-0315 tRNA-Ala
  539. Cytobacillus sp. NJ13 tRNA-Ala
  540. Cytobacillus sp. OWB-43 tRNA-Ala
  541. Cytobacillus stercorigallinarum tRNA-Ala
  542. Cytobacillus sp. T106 tRNA-Ala
  543. Domibacillus aminovorans tRNA-Ala
  544. Domibacillus epiphyticus tRNA-Ala
  545. Domibacillus iocasae tRNA-Ala
  546. Domibacillus sp. 8LH tRNA-Ala
  547. Domibacillus sp. DTU_2020_1001157_1_SI_ALB_TIR_016 tRNA-Ala
  548. Ectobacillus funiculus tRNA-Ala
  549. Ectobacillus ponti tRNA-Ala
  550. Embleya sp. NPDC056538 tRNA-Ala
  551. Embleya sp. NPDC056575 tRNA-Ala
  552. Embleya sp. NPDC059237 tRNA-Ala
  553. Enterococcus faecalis tRNA-Ala(tgc)
  554. Enterococcus faecium tRNA-Ala
  555. Erysipelatoclostridium sp. An15 tRNA-Ala
  556. Erysipelatoclostridium sp. An173 tRNA-Ala
  557. Escherichia coli tRNA-Ala
  558. [Eubacterium] sulci (human oral metagenome) tRNA-Ala
  559. Evansella sp. AB-P1 tRNA-Ala
  560. Exiguobacterium sp. tRNA-Ala
  561. Falsibacillus albus tRNA-Ala
  562. Filobacillus milosensis tRNA-Ala
  563. Fredinandcohnia sp. FSL W7-1320 tRNA-Ala
  564. Fredinandcohnia sp. QZ13 tRNA-Ala
  565. Gemella bergeri ATCC 700627 tRNA-Ala
  566. Gemella haemolysans M341 tRNA-Ala
  567. Gemella haemolysans tRNA-Ala(tgc)
  568. Gemella morbillorum M424 tRNA-Ala
  569. Gemella morbillorum tRNA-Ala(tgc)
  570. Gemella sanguinis M325 tRNA-Ala
  571. Gemella sanguinis tRNA-Ala
  572. Gemella sp. 19428wG2_WT2a tRNA-Ala
  573. Gemella sp. 20925_1_85 tRNA-Ala
  574. Gemella sp. 27098_8_149 tRNA-Ala
  575. Gemella sp. 27098_8_155 tRNA-Ala
  576. Gemella sp. 27098_8_92 tRNA-Ala
  577. Gemella sp. GL1.1 tRNA-Ala
  578. Gemella sp. GL1 tRNA-Ala
  579. Gemella sp. ND 6198 tRNA-Ala
  580. Gemella sp. oral taxon 928 tRNA-Ala
  581. Gemella sp. tRNA-Ala
  582. Gemella sp. WT2a tRNA-Ala
  583. Geomicrobium sediminis tRNA-Ala
  584. Geomicrobium sp. JSM 1781026 tRNA-Ala
  585. Gracilibacillus halotolerans tRNA-Ala
  586. Gracilibacillus marinus tRNA-Ala
  587. Gracilibacillus pellucidus Gracilibacillus sp. S3-1-1 tRNA-Ala
  588. Gracilibacillus salitolerans tRNA-Ala
  589. Gracilibacillus salinarum tRNA-Ala
  590. Gracilibacillus caseinilyticus tRNA-Ala
  591. Gracilibacillus oryzae tRNA-Ala
  592. Gracilibacillus thailandensis tRNA-Ala
  593. Gracilibacillus xinjiangensis tRNA-Ala
  594. Halalkalibacillus sediminis tRNA-Ala
  595. Halalkalibacterium halodurans C-125 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  596. Halalkalibacterium halodurans tRNA-Ala
  597. Halalkalibacter sp. AB-rgal2 tRNA-Ala
  598. Halobacillus andaensis tRNA-Ala
  599. Halobacillus campisalis tRNA-Ala
  600. Halobacillus dabanensis tRNA_Ala_TGC
  601. Halobacillus halophilus DSM 2266 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  602. Halobacillus halophilus tRNA-Ala
  603. Halobacillus karajensis tRNA-Ala
  604. Halobacillus kuroshimensis tRNA-Ala
  605. Halobacillus litoralis tRNA-Ala
  606. Halobacillus locisalis tRNA-Ala
  607. Halobacillus mangrovi tRNA-Ala
  608. Halobacillus naozhouensis tRNA-Ala
  609. Halobacillus profundi tRNA-Ala
  610. Halobacillus salinus tRNA-Ala
  611. Halobacillus seohaensis tRNA-Ala
  612. Halobacillus sp. A5 tRNA-Ala
  613. Halobacillus sp. ACCC02827 tRNA-Ala
  614. Halobacillus sp. BBL2006 tRNA-Ala
  615. Halobacillus sp. FAM 114 tRNA-Ala
  616. Halobacillus sp. FAM 115 tRNA-Ala
  617. Halobacillus sp. GSS1 tRNA-Ala
  618. Halobacillus sp. HZG1 tRNA-Ala
  619. Halobacillus sp. IS-Hb2 tRNA-Ala
  620. Halobacillus yeomjeoni tRNA-Ala
  621. Halobacillus sp. MO56 tRNA-Ala
  622. Halobacillus fulvus tRNA-Ala
  623. Halobacillus salinarum tRNA-Ala
  624. Halobacillus amylolyticus tRNA-Ala
  625. Halobacillus shinanisalinarum tRNA-Ala
  626. Halobacillus sp. SY10 tRNA-Ala
  627. Halobacillus trueperi tRNA-Ala
  628. Halobacillus yeomjeoni tRNA-Ala
  629. Halolactibacillus alkaliphilus tRNA_Ala_TGC
  630. Halolactibacillus halophilus tRNA-Ala
  631. Halolactibacillus miurensis tRNA-Ala
  632. Halomonas urumqiensis tRNA-Ala
  633. Halotalea alkalilenta tRNA-Ala
  634. Heyndrickxia acidicola tRNA-Ala
  635. Heyndrickxia coagulans 2-6 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  636. Heyndrickxia coagulans 36D1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  637. Heyndrickxia coagulans DSM 1 = ATCC 7050 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  638. Heyndrickxia coagulans tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  639. Heyndrickxia faecalis tRNA-Ala
  640. Heyndrickxia ginsengihumi tRNA-Ala
  641. Heyndrickxia oleronia tRNA-Ala
  642. Heyndrickxia shackletonii tRNA-Ala
  643. Heyndrickxia sp. FSL K6-6286 tRNA-Ala
  644. Heyndrickxia sp. FSL W8-0423 tRNA-Ala
  645. Heyndrickxia sp. FSL W8-0496 tRNA-Ala
  646. Heyndrickxia sporothermodurans tRNA-Ala
  647. Isoptericola sp. NPDC056573 tRNA-Ala
  648. Kitasatospora purpeofusca tRNA-Ala
  649. Kitasatospora sp. NPDC056184 tRNA-Ala
  650. Kitasatospora sp. NPDC056651 tRNA-Ala
  651. Kitasatospora sp. NPDC057692 tRNA-Ala
  652. Kitasatospora sp. NPDC057904 tRNA-Ala
  653. Kitasatospora sp. NPDC057940 tRNA-Ala
  654. Kitasatospora sp. NPDC058162 tRNA-Ala
  655. Kitasatospora sp. NPDC058170 tRNA-Ala
  656. Kitasatospora sp. NPDC059462 tRNA-Ala
  657. Klebsiella pneumoniae tRNA-Ala
  658. Lederbergia citrisecunda tRNA-Ala
  659. Lederbergia citri tRNA-Ala
  660. Lederbergia ruris tRNA-Ala
  661. Lederbergia sp. NSJ-179 tRNA-Ala
  662. Leeuwenhoekiella sp. tRNA-Ala
  663. Lentibacillus juripiscarius tRNA-Ala
  664. Lentibacillus populi tRNA-Ala
  665. Lentibacillus salinarum tRNA-Ala
  666. Lentibacillus sp. CBA3610 tRNA-Ala
  667. Lentibacillus sp. L22 tRNA-Ala
  668. Lentibacillus sp. N15 tRNA-Ala
  669. Lentibacillus cibarius tRNA-Ala
  670. Lentibacillus cibarius tRNA-Ala
  671. Lentibacillus lipolyticus tRNA-Ala
  672. Listeria aquatica FSL S10-1188 tRNA-Ala
  673. Listeria aquatica tRNA-Ala
  674. Listeria booriae tRNA-Ala(tgc)
  675. Listeriaceae bacterium FSL A5-0209 tRNA-Ala
  676. Listeria cornellensis FSL F6-0969 tRNA-Ala
  677. Listeria cossartiae subsp. cayugensis tRNA-Ala
  678. Listeria fleischmannii FSL S10-1203 tRNA-Ala
  679. Listeria fleischmannii subsp. coloradonensis tRNA-Ala(tgc)
  680. Listeria fleischmannii subsp. fleischmannii LU2006-1 tRNA-Ala
  681. Listeria fleischmannii subsp. fleischmannii tRNA-Ala(tgc)
  682. Listeria fleischmannii tRNA-Ala
  683. Listeria floridensis FSL S10-1187 tRNA-Ala
  684. Listeria grandensis FSL F6-0971 tRNA-Ala
  685. Listeria grandensis tRNA-Ala
  686. Listeria grayi FSL F6-1183 tRNA-Ala
  687. Listeria grayi tRNA-Ala(tgc)
  688. Listeria innocua Clip11262 transfert RNA-Ala
  689. Listeria innocua tRNA-Ala(tgc)
  690. Listeria ivanovii Ala-tRNA
  691. Listeria ivanovii subsp. ivanovii PAM 55 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  692. Listeria ivanovii subsp. ivanovii tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  693. Listeria ivanovii subsp. londoniensis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  694. Listeria ivanovii WSLC3009 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  695. Listeria kieliensis tRNA-Ala
  696. Listeria marthii tRNA-Ala
  697. Listeria monocytogenes 07PF0776 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  698. Listeria monocytogenes 08-5578 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  699. Listeria monocytogenes 08-5923 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  700. Listeria monocytogenes 10403S tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  701. Listeria monocytogenes 4423 tRNA-Ala
  702. Listeria monocytogenes 6179 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  703. Listeria monocytogenes ATCC 19115 tRNA-Ala
  704. Listeria monocytogenes ATCC 19117 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  705. Listeria monocytogenes CC70B tRNA-Ala
  706. Listeria monocytogenes CFSAN002184 tRNA-Ala
  707. Listeria monocytogenes CFSAN002191 tRNA-Ala
  708. Listeria monocytogenes CFSAN002202 tRNA-Ala
  709. Listeria monocytogenes CFSAN002208 tRNA-Ala
  710. Listeria monocytogenes CFSAN002349 tRNA-Ala
  711. Listeria monocytogenes CFSAN002351 tRNA-Ala
  712. Listeria monocytogenes CFSAN002355 tRNA-Ala
  713. Listeria monocytogenes CFSAN002357 tRNA-Ala
  714. Listeria monocytogenes CFSAN003811 tRNA-Ala
  715. Listeria monocytogenes CFSAN003824 tRNA-Ala
  716. Listeria monocytogenes CFSAN003825 tRNA-Ala
  717. Listeria monocytogenes EGD-e transfert RNA-Ala
  718. Listeria monocytogenes EGD tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  719. Listeria monocytogenes Finland 1998 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  720. Listeria monocytogenes FSL F6-684 tRNA-Ala
  721. Listeria monocytogenes FSL J1-175 tRNA-Ala
  722. Listeria monocytogenes FSL J1-208 tRNA-Ala
  723. Listeria monocytogenes FSL R2-561 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  724. Listeria monocytogenes HCC23 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  725. Listeria monocytogenes J0161 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  726. Listeria monocytogenes J1-220 tRNA-Ala
  727. Listeria monocytogenes J1816 tRNA-Ala
  728. Listeria monocytogenes L312 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  729. Listeria monocytogenes L99 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  730. Listeria monocytogenes LIS0063 tRNA-Ala
  731. Listeria monocytogenes LIS0077 tRNA-Ala
  732. Listeria monocytogenes LO28 tRNA-Ala
  733. Listeria monocytogenes M7 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  734. Listeria monocytogenes N53-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  735. Listeria monocytogenes QOC1 tRNA-Ala
  736. Listeria monocytogenes QOC2 tRNA-Ala
  737. Listeria monocytogenes R479a tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  738. Listeria monocytogenes serotype 1/2a str. 02-5993 tRNA-Ala
  739. Listeria monocytogenes serotype 1/2a str. 04-5457 tRNA-Ala
  740. Listeria monocytogenes serotype 1/2a str. 08-6056 tRNA-Ala
  741. Listeria monocytogenes serotype 1/2a str. 08-6569 tRNA-Ala
  742. Listeria monocytogenes serotype 1/2a str. 08-6997 tRNA-Ala
  743. Listeria monocytogenes serotype 1/2a str. 08-7374 tRNA-Ala
  744. Listeria monocytogenes serotype 1/2a str. 08-7669 tRNA-Ala
  745. Listeria monocytogenes serotype 1/2a str. 10-0812 tRNA-Ala
  746. Listeria monocytogenes serotype 1/2a str. 10-0813 tRNA-Ala
  747. Listeria monocytogenes serotype 1/2a str. 10-0814 tRNA-Ala
  748. Listeria monocytogenes serotype 1/2a str. 10-0815 tRNA-Ala
  749. Listeria monocytogenes serotype 1/2a str. 10-0933 tRNA-Ala
  750. Listeria monocytogenes serotype 1/2a str. 10-0934 tRNA-Ala
  751. Listeria monocytogenes serotype 1/2a str. 10-1046 tRNA-Ala
  752. Listeria monocytogenes serotype 1/2a str. 10-1047 tRNA-Ala
  753. Listeria monocytogenes serotype 1/2a str. 10-1321 tRNA-Ala
  754. Listeria monocytogenes serotype 1/2a str. 10-4754 tRNA-Ala
  755. Listeria monocytogenes serotype 1/2a str. 10-4758 tRNA-Ala
  756. Listeria monocytogenes serotype 1/2a str. 10-5024 tRNA-Ala
  757. Listeria monocytogenes serotype 1/2a str. 88-0478 tRNA-Ala
  758. Listeria monocytogenes serotype 1/2a str. 95-0093 tRNA-Ala
  759. Listeria monocytogenes serotype 1/2a str. 98-2035 tRNA-Ala
  760. Listeria monocytogenes serotype 1/2a str. 99-6370 tRNA-Ala
  761. Listeria monocytogenes serotype 1/2a tRNA-Ala
  762. Listeria monocytogenes serotype 1/2b str. 10-0810 tRNA-Ala
  763. Listeria monocytogenes serotype 1/2b str. 10-0811 tRNA-Ala
  764. Listeria monocytogenes serotype 1/2b tRNA-Ala
  765. Listeria monocytogenes serotype 1/2c str. 10-5025 tRNA-Ala
  766. Listeria monocytogenes serotype 1/2c str. 10-5026 tRNA-Ala
  767. Listeria monocytogenes serotype 1/2c tRNA-Ala
  768. Listeria monocytogenes serotype 3a tRNA-Ala
  769. Listeria monocytogenes serotype 3b tRNA-Ala
  770. Listeria monocytogenes serotype 3c str. 10-5027 tRNA-Ala
  771. Listeria monocytogenes serotype 3c tRNA-Ala
  772. Listeria monocytogenes serotype 4a tRNA-Ala
  773. Listeria monocytogenes serotype 4b str. 02-1103 tRNA-Ala
  774. Listeria monocytogenes serotype 4b str. 02-1289 tRNA-Ala
  775. Listeria monocytogenes serotype 4b str. 02-1792 tRNA-Ala
  776. Listeria monocytogenes serotype 4b str. 02-6679 tRNA-Ala
  777. Listeria monocytogenes serotype 4b str. 02-6680 tRNA-Ala
  778. Listeria monocytogenes serotype 4b str. 10-0809 tRNA-Ala
  779. Listeria monocytogenes serotype 4b str. 81-0558 tRNA-Ala
  780. Listeria monocytogenes serotype 4b str. 81-0592 tRNA-Ala
  781. Listeria monocytogenes serotype 4b str. 81-0861 tRNA-Ala
  782. Listeria monocytogenes serotype 4b str. CLIP 80459 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  783. Listeria monocytogenes serotype 4b str. F2365 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  784. Listeria monocytogenes serotype 4b str. H7858 tRNA-Ala
  785. Listeria monocytogenes serotype 4b str. LIS0087 tRNA-Ala
  786. Listeria monocytogenes serotype 4b str. LL195 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  787. Listeria monocytogenes serotype 4b tRNA-Ala
  788. Listeria monocytogenes serotype 4bV str. LS542 tRNA-Ala
  789. Listeria monocytogenes serotype 4bV str. LS642 tRNA-Ala
  790. Listeria monocytogenes serotype 4bV str. LS643 tRNA-Ala
  791. Listeria monocytogenes serotype 4bV str. LS644 tRNA-Ala
  792. Listeria monocytogenes serotype 4bV str. LS645 tRNA-Ala
  793. Listeria monocytogenes serotype 4c tRNA-Ala
  794. Listeria monocytogenes serotype 7 str. SLCC2482 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  795. Listeria monocytogenes SHL005 tRNA-Ala
  796. Listeria monocytogenes SHL006 tRNA-Ala
  797. Listeria monocytogenes SHL007 tRNA-Ala
  798. Listeria monocytogenes SHL008 tRNA-Ala
  799. Listeria monocytogenes SHL009 tRNA-Ala
  800. Listeria monocytogenes SHL010 tRNA-Ala
  801. Listeria monocytogenes SHL011 tRNA-Ala
  802. Listeria monocytogenes SHL012 tRNA-Ala
  803. Listeria monocytogenes SHL013 tRNA-Ala
  804. Listeria monocytogenes SLCC2372 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  805. Listeria monocytogenes SLCC2376 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  806. Listeria monocytogenes SLCC2378 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  807. Listeria monocytogenes SLCC2479 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  808. Listeria monocytogenes SLCC2540 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  809. Listeria monocytogenes SLCC2755 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  810. Listeria monocytogenes SLCC5850 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  811. Listeria monocytogenes SLCC7179 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  812. Listeria monocytogenes str. Scott A tRNA-Ala
  813. Listeria monocytogenes tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  814. Listeria monocytogenes WSLC1001 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  815. Listeria monocytogenes WSLC1042 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  816. Listeria newyorkensis tRNA-Ala(tgc)
  817. Listeria riparia FSL S10-1204 tRNA-Ala
  818. Listeria rocourtiae FSL F6-920 tRNA-Ala
  819. Listeria rocourtiae tRNA-Ala
  820. Listeria seeligeri serovar 1/2b str. SLCC3954 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  821. Listeria seeligeri tRNA-Ala(tgc)
  822. Listeria swaminathanii tRNA-Ala
  823. Listeria farberi tRNA-Ala
  824. Listeria farberi tRNA-Ala
  825. Listeria farberi tRNA-Ala
  826. Listeria immobilis tRNA-Ala
  827. Listeria immobilis tRNA-Ala
  828. Listeria sp. FSL L8-0308 tRNA-Ala
  829. Listeria rustica tRNA-Ala
  830. Listeria sp. SHR_NRA_18 tRNA-Ala
  831. Listeria swaminathanii tRNA-Ala
  832. Listeria weihenstephanensis FSL R9-0317 tRNA-Ala
  833. Listeria weihenstephanensis tRNA-Ala
  834. Listeria welshimeri serovar 6b str. SLCC5334 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  835. Listeria welshimeri tRNA-Ala(tgc)
  836. Lysinibacillus sphaericus tRNA-Ala
  837. Mangrovibacillus sp. Mu-81 tRNA-Ala
  838. Margalitia sp. FSL K6-0131 tRNA-Ala
  839. Marinococcus halophilus tRNA-Ala
  840. Marinococcus sp. PL1-022 tRNA-Ala
  841. Mesobacillus foraminis tRNA-Ala
  842. Mesobacillus maritimus tRNA-Ala
  843. Mesobacillus stamsii tRNA-Ala
  844. Mesobacillus zeae tRNA-Ala(tgc)
  845. Metabacillus bambusae tRNA-Ala
  846. Metabacillus endolithicus tRNA-Ala
  847. Metabacillus halosaccharovorans tRNA-Ala
  848. Metabacillus litoralis tRNA-Ala
  849. Metabacillus malikii tRNA-Ala
  850. Metabacillus niabensis tRNA-Ala
  851. Metabacillus sp. B2-18 tRNA-Ala
  852. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Ala
  853. Metabacillus elymi tRNA-Ala
  854. Metabacillus sp. tRNA-Ala
  855. Methylobacterium frigidaeris tRNA-Ala
  856. Methylobacterium sp. NPDC097428 tRNA-Ala
  857. Micromonospora aurantiaca (nom. illeg.) Micromonospora aurantiaca tRNA-Ala
  858. Mycobacteroides abscessus subsp. abscessus tRNA-Ala(tgc)
  859. Mycobacteroides abscessus subsp. massiliense tRNA-Ala(tgc)
  860. Natronobacillus azotifigens tRNA-Ala
  861. Neobacillus citreus tRNA-Ala
  862. Neobacillus drentensis tRNA-Ala
  863. Neobacillus driksii tRNA-Ala
  864. Neobacillus ginsengisoli tRNA-Ala
  865. Neobacillus mesonae tRNA-Ala
  866. Neobacillus niacini tRNA-Ala
  867. Neobacillus novalis tRNA-Ala
  868. Neobacillus paridis tRNA-Ala
  869. Neobacillus pocheonensis tRNA-Ala
  870. Neobacillus rhizophilus tRNA-Ala
  871. Neobacillus sedimentimangrovi tRNA-Ala
  872. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Ala
  873. Neobacillus sp. 204 tRNA-Ala
  874. Neobacillus sp. 211 tRNA-Ala
  875. Neobacillus sp. 3P2-tot-E-2 tRNA-Ala
  876. Neobacillus sp. BF23-41 tRNA-Ala
  877. Neobacillus sp. CF12 tRNA-Ala
  878. Neobacillus sp. DY30 tRNA-Ala
  879. Neobacillus sp. GCM10023253 tRNA-Ala
  880. Neobacillus rhizosphaerae tRNA-Ala
  881. Neobacillus sp. MM2021_6 tRNA-Ala
  882. Neobacillus sp. NPDC058068 tRNA-Ala
  883. Neobacillus sp. NPDC093182 tRNA-Ala
  884. Neobacillus sp. OS1-2 tRNA-Ala
  885. Neobacillus sp. OS1-32 tRNA-Ala
  886. Neobacillus sp. OS1-33 tRNA-Ala
  887. Neobacillus sp. PS2-9 tRNA-Ala
  888. Neobacillus sp. PS3-34 tRNA-Ala
  889. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Ala
  890. Neobacillus sp. tRNA-Ala
  891. Neobacillus sp. WH10 tRNA-Ala
  892. Neobacillus sp. YX16 tRNA-Ala
  893. Neobacillus thermocopriae tRNA-Ala
  894. Neobacillus vireti tRNA-Ala
  895. Niallia oryzisoli tRNA-Ala
  896. Niallia sp. XMNu-256 tRNA-Ala
  897. Nocardia ignorata tRNA-Ala
  898. Nocardia panacis tRNA-Ala
  899. Nocardia tengchongensis tRNA-Ala
  900. Nocardioides sp. YIM B13467 tRNA-Ala
  901. Oceanobacillus bengalensis tRNA-Ala
  902. Oceanobacillus caeni tRNA-Ala
  903. Oceanobacillus halophilus tRNA-Ala
  904. Oceanobacillus sp. FSL K6-0118 tRNA-Ala
  905. Odoribacter splanchnicus tRNA-Ala
  906. Oikeobacillus pervagus tRNA-Ala
  907. Oribacterium sinus tRNA-Ala
  908. Paenarthrobacter sp. NPDC056912 tRNA-Ala
  909. Paenibacillus sp. BSR1-1 tRNA-Ala
  910. Paenibacillus sp. FSL R5-0490 tRNA-Ala
  911. Paenibacillus sp. ICGEB2008 tRNA-Ala
  912. Pallidibacillus pasinlerensis tRNA-Ala
  913. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Ala
  914. Pallidibacillus thermolactis tRNA-Ala
  915. Paraliobacillus quinghaiensis tRNA-Ala
  916. Paraliobacillus ryukyuensis tRNA-Ala
  917. Paraliobacillus sp. JSM ZJ581 tRNA-Ala
  918. Paraliobacillus sp. PM-2 tRNA-Ala
  919. Perspicuibacillus lycopersici tRNA-Ala
  920. Piscibacillus salipiscarius tRNA-Ala
  921. Pontibacillus chungwhensis tRNA-Ala
  922. Pontibacillus salipaludis tRNA-Ala
  923. Pradoshia sp. D12 tRNA-Ala
  924. Proteus vulgaris tRNA-Ala
  925. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Ala
  926. Pseudobacillus sp. FSL P4-0506 tRNA-Ala
  927. Pseudomonadota bacterium tRNA-Ala
  928. Pseudomonas cedrina subsp. cedrina tRNA-Ala
  929. Bacillus subtilis A29 tRNA-Ala
  930. Pseudomonas sp. EGD-AK9 tRNA-Ala
  931. Pseudomonas sp. ISL-84 tRNA-Ala
  932. Pullulanibacillus sp. KACC 23026 tRNA-Ala
  933. Radiobacillus kanasensis tRNA-Ala
  934. Rathayibacter tritici tRNA-Ala
  935. Rhizobium sp. SIMBA_035 tRNA-Ala
  936. Rhodococcus koreensis tRNA-Ala
  937. Rhodococcus qingshengii tRNA-Ala
  938. Rhodothalassium salexigens DSM 2132 tRNA-Ala
  939. Anoxybacillus andreesenii tRNA-Ala
  940. Robertmurraya crescens tRNA-Ala
  941. Rossellomorea aquimaris tRNA-Ala
  942. Rossellomorea oryzaecorticis tRNA-Ala
  943. Rossellomorea sp. AcN35-11 tRNA-Ala
  944. Rossellomorea sp. DA94 tRNA-Ala
  945. Rossellomorea sp. GCM10028870 tRNA-Ala
  946. Rossellomorea sp. KS-H15a tRNA-Ala
  947. Rossellomorea sp. LJF3 tRNA-Ala
  948. Rossellomorea sp. NPDC077527 tRNA-Ala
  949. Rossellomorea sp. SC111 tRNA-Ala
  950. Rossellomorea sp. y25 tRNA-Ala
  951. Rossellomorea yichunensis tRNA-Ala
  952. Rossellomorea sp. YZS02 tRNA-Ala
  953. Salimicrobium halophilum tRNA_Ala_TGC
  954. Salimicrobium jeotgali tRNA-Ala
  955. Salimicrobium sp. PL1-032A tRNA-Ala
  956. Salimicrobium humidisoli tRNA-Ala
  957. Salinibacillus aidingensis tRNA-Ala
  958. Salipaludibacillus agaradhaerens tRNA-Ala
  959. Salipaludibacillus keqinensis tRNA-Ala
  960. Salipaludibacillus sp. LMS25 tRNA-Ala
  961. Salisediminibacterium halotolerans tRNA-Ala
  962. Salmonella enterica subsp. enterica serovar Agona tRNA-Ala
  963. Scopulibacillus cellulosilyticus tRNA-Ala
  964. Scopulibacillus daqui tRNA-Ala
  965. Sediminibacillus dalangtanensis tRNA-Ala
  966. Shouchella clausii KSM-K16 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  967. Shouchella clausii tRNA-Ala
  968. Shouchella hunanensis tRNA-Ala
  969. Shouchella lehensis G1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  970. Shouchella miscanthi tRNA-Ala
  971. Shouchella rhizosphaerae tRNA-Ala
  972. Shouchella sp. 1P01AA tRNA-Ala
  973. Shouchella sp. 1P09AA tRNA-Ala
  974. Shouchella sp. JSM 1781072 tRNA-Ala
  975. Siminovitchia fordii tRNA-Ala
  976. Siminovitchia fortis tRNA-Ala
  977. Siminovitchia sediminis tRNA-Ala
  978. Siminovitchia sp. 179-K 8D1 HS tRNA-Ala
  979. Siminovitchia sp. FSL H7-0308 tRNA-Ala
  980. Siminovitchia sp. FSL W7-1587 tRNA-Ala
  981. Siminovitchia terrae tRNA-Ala
  982. Siminovitchia thermophila tRNA-Ala
  983. Solibacillus sp. FSL R7-0682 tRNA-Ala
  984. Bacillus velezensis A3 tRNA-Ala
  985. Sporolactobacillaceae bacterium tRNA-Ala
  986. Sporolactobacillus shoreicorticis tRNA-Ala
  987. Sporolactobacillus sp. STSJ-5 tRNA-Ala
  988. Sporolactobacillus terrae tRNA-Ala
  989. Sporosarcina globispora tRNA-Ala
  990. Staphylococcus aureus tRNA-Ala
  991. Staphylococcus epidermidis tRNA-Ala
  992. Stenotrophomonas bentonitica tRNA-Ala
  993. Streptococcus pneumoniae tRNA-Ala(tgc)
  994. Streptococcus pyogenes tRNA-Ala
  995. Streptococcus salivarius tRNA-Ala
  996. Streptococcus sp. UMB1385 tRNA-Ala
  997. Streptomyces albidoflavus tRNA-Ala
  998. Streptomyces anulatus tRNA-Ala
  999. Streptomyces bikiniensis tRNA-Ala
  1000. Streptomyces cinereoruber tRNA-Ala
  1001. Streptomyces cyaneofuscatus tRNA-Ala
  1002. Streptomyces erythrochromogenes tRNA-Ala
  1003. Streptomyces griseus Streptomyces fimicarius tRNA-Ala
  1004. Streptomyces fungicidicus tRNA-Ala
  1005. Streptomyces globisporus tRNA-Ala
  1006. Streptomyces griseoaurantiacus tRNA-Ala
  1007. Streptomyces griseoincarnatus tRNA-Ala
  1008. Streptomyces griseus tRNA-Ala
  1009. Streptomyces hydrogenans tRNA-Ala
  1010. Streptomyces mirabilis tRNA-Ala
  1011. Streptomyces mutabilis tRNA-Ala
  1012. Streptomyces niveus tRNA-Ala
  1013. Streptomyces olivaceus tRNA-Ala
  1014. Streptomyces rochei tRNA-Ala
  1015. Streptomyces roseolus tRNA-Ala
  1016. Streptomyces rubiginosohelvolus tRNA-Ala
  1017. Streptomyces sp. NPDC053429 tRNA-Ala
  1018. Streptomyces sp. NPDC056084 tRNA-Ala
  1019. Streptomyces sp. NPDC056086 tRNA-Ala
  1020. Streptomyces sp. NPDC056105 tRNA-Ala
  1021. Streptomyces sp. NPDC056127 tRNA-Ala
  1022. Streptomyces sp. NPDC056161 tRNA-Ala
  1023. Streptomyces sp. NPDC056308 tRNA-Ala
  1024. Streptomyces sp. NPDC056401 tRNA-Ala
  1025. Streptomyces sp. NPDC056580 tRNA-Ala
  1026. Streptomyces sp. NPDC056639 tRNA-Ala
  1027. Streptomyces sp. NPDC056647 tRNA-Ala
  1028. Streptomyces sp. NPDC056664 tRNA-Ala
  1029. Streptomyces sp. NPDC056734 tRNA-Ala
  1030. Streptomyces sp. NPDC056910 tRNA-Ala
  1031. Streptomyces sp. NPDC056944 tRNA-Ala
  1032. Streptomyces sp. NPDC057002 tRNA-Ala
  1033. Streptomyces sp. NPDC057092 tRNA-Ala
  1034. Streptomyces sp. NPDC057136 tRNA-Ala
  1035. Streptomyces sp. NPDC057239 tRNA-Ala
  1036. Streptomyces sp. NPDC057286 tRNA-Ala
  1037. Streptomyces sp. NPDC057287 tRNA-Ala
  1038. Streptomyces sp. NPDC057293 tRNA-Ala
  1039. Streptomyces sp. NPDC057298 tRNA-Ala
  1040. Streptomyces sp. NPDC057438 tRNA-Ala
  1041. Streptomyces sp. NPDC057555 tRNA-Ala
  1042. Streptomyces sp. NPDC057579 tRNA-Ala
  1043. Streptomyces sp. NPDC057596 tRNA-Ala
  1044. Streptomyces sp. NPDC057636 tRNA-Ala
  1045. Streptomyces sp. NPDC057651 tRNA-Ala
  1046. Streptomyces sp. NPDC057689 tRNA-Ala
  1047. Streptomyces sp. NPDC057697 tRNA-Ala
  1048. Streptomyces sp. NPDC057740 tRNA-Ala
  1049. Streptomyces sp. NPDC057743 tRNA-Ala
  1050. Streptomyces sp. NPDC057746 tRNA-Ala
  1051. Streptomyces sp. NPDC058052 tRNA-Ala
  1052. Streptomyces sp. NPDC058142 tRNA-Ala
  1053. Streptomyces sp. NPDC058279 tRNA-Ala
  1054. Streptomyces sp. NPDC059452 tRNA-Ala
  1055. Streptomyces sp. NPDC059919 tRNA-Ala
  1056. Streptomyces sp. NPDC060232 tRNA-Ala
  1057. Streptomyces sp. NPDC126933 tRNA-Ala
  1058. Streptomyces sp. NPDC127132 tRNA-Ala
  1059. Streptomyces sp. NPDC127172 tRNA-Ala
  1060. Streptomyces tendae tRNA-Ala
  1061. Streptomyces venezuelae tRNA-Ala
  1062. Streptomyces zhihengii tRNA-Ala
  1063. Sutcliffiella horikoshii tRNA-Ala
  1064. Sutcliffiella sp. FSL R7-0096 tRNA-Ala
  1065. Sutcliffiella sp. NPDC057660 tRNA-Ala
  1066. Tenuibacillus multivorans tRNA-Ala
  1067. Terribacillus aidingensis tRNA-Ala
  1068. Terribacillus saccharophilus tRNA-Ala
  1069. Terribacillus sp. FSL K6-0262 tRNA-Ala
  1070. Terrihalobacillus insolitus tRNA-Ala
  1071. Terrilactibacillus laevilacticus tRNA-Ala
  1072. Terrilactibacillus tamarindi tRNA-Ala
  1073. Thalassobacillus devorans tRNA-Ala
  1074. Thalassobacillus hwangdonensis tRNA-Ala
  1075. Thalassobacillus sp. FIB228 tRNA-Ala
  1076. Tigheibacillus jepli tRNA-Ala
  1077. Tistrella mobilis tRNA-Ala
  1078. Ureibacillus sp. tRNA-Ala
  1079. Variovorax sp. CCNWLW225 tRNA-Ala
  1080. Tigheibacillus halophilus Virgibacillus halophilus tRNA-Ala
  1081. Paracerasibacillus soli tRNA-Ala
  1082. Virgibacillus sp. MSP4-1 tRNA-Ala
  1083. Weizmannia acidilactici tRNA-Ala
  1084. Weizmannia sp. CD-2023 tRNA-Ala
  1085. Weizmannia sp. FSL K6-0777 tRNA-Ala
  1086. Weizmannia sp. FSL K6-3076 tRNA-Ala
  1087. Weizmannia sp. FSL W8-0401 tRNA-Ala
  1088. Weizmannia sp. FSL W8-0676 tRNA-Ala
  1089. Weizmannia sp. FSL W8-1119 tRNA-Ala
  1090. Weizmannia sp. WK01 tRNA-Ala
  1091. Xanthomonas citri pv. citri tRNA-Ala
Relationships

Molecular Relationships

2D structure

Loading 2D structure...