Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus shivajii tRNA-Ala secondary structure diagram

Bacillus shivajii tRNA-Ala URS00002F180C_1983719

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGCCUUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCAGCGGUUCGAUCCCGCUAGGCUCCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,299 other species

  1. Acholeplasmatales bacterium tRNA-Ala
  2. Acinetobacter baumannii tRNA-Ala(tgc)
  3. Aeribacillus alveayuensis tRNA-Ala
  4. Aeribacillus composti tRNA-Ala
  5. Aeribacillus pallidus tRNA-Ala
  6. Aeribacillus sp. FSL K6-1121 tRNA-Ala
  7. Aeribacillus sp. FSL K6-1305 tRNA-Ala
  8. Aeribacillus sp. FSL k6-2211 tRNA-Ala
  9. Aeribacillus sp. FSL K6-2833 tRNA-Ala
  10. Aeribacillus sp. FSL K6-2848 tRNA-Ala
  11. Aeribacillus sp. FSL K6-3256 tRNA-Ala
  12. Aeribacillus sp. FSL K6-8210 tRNA-Ala
  13. Aeribacillus sp. FSL K6-8394 tRNA-Ala
  14. Aeribacillus sp. FSL M8-0235 tRNA-Ala
  15. Aeribacillus sp. FSL M8-0254 tRNA-Ala
  16. Aeribacillus sp. FSL W8-0870 tRNA-Ala
  17. Aeribacillus sp. SP014 tRNA-Ala
  18. Aeromicrobium ponti tRNA-Ala
  19. Aeromonas veronii tRNA-Ala
  20. Agathobacter ruminis tRNA-Ala
  21. Aliibacillus thermotolerans tRNA-Ala
  22. Alkalibacillus almallahensis tRNA-Ala
  23. Alkalibacillus flavidus tRNA-Ala
  24. Alkalibacillus salilacus tRNA-Ala
  25. Alkalibacillus silvisoli tRNA-Ala
  26. Alkalibacillus sp. S2W tRNA-Ala
  27. Alkalicoccobacillus gibsonii tRNA-Ala
  28. Alkalicoccus chagannorensis tRNA-Ala(tgc)
  29. Alkalicoccus halolimnae tRNA-Ala
  30. Alkalicoccus saliphilus tRNA-Ala
  31. Alkalihalobacillus alcalophilus tRNA-Ala
  32. Alkalihalobacillus phoenicis tRNA-Ala
  33. Shouchella hunanensis tRNA-Ala
  34. Alkalihalobacillus sp. LMS6 tRNA-Ala
  35. Allobacillus halotolerans tRNA-Ala
  36. Allobacillus sp. GCM10007489 tRNA-Ala
  37. Allobacillus sp. GCM10007490 tRNA-Ala
  38. Allobacillus sp. GCM10007491 tRNA-Ala
  39. Allobacillus sp. SKP2-8 tRNA-Ala
  40. Allobacillus salarius tRNA-Ala
  41. Allobacillus saliphilus tRNA-Ala
  42. Alphaproteobacteria bacterium tRNA-Ala
  43. Alteribacillus sp. JSM 102045 tRNA-Ala
  44. Alteribacter salitolerans tRNA-Ala
  45. Amphibacillus cookii tRNA-Ala
  46. Amphibacillus sp. LTW-01 tRNA-Ala
  47. Amphibacillus sp. MSJ-3 tRNA-Ala
  48. Amphibacillus sp. Q70 tRNA-Ala
  49. Anaerorhabdus sp. tRNA-Ala
  50. Aneurinibacillus aneurinilyticus tRNA-Ala
  51. [Anoxybacillus] calidus tRNA-Ala
  52. Aquibacillus albus tRNA-Ala
  53. Aquibacillus koreensis tRNA-Ala
  54. Aquibacillus rhizosphaerae tRNA-Ala
  55. Aquibacillus salsiterrae tRNA-Ala
  56. Arthrobacter sp. NPDC057009 tRNA-Ala
  57. Pradoshia eiseniae tRNA-Ala
  58. Bacillaceae bacterium JMAK1 tRNA-Ala
  59. Bacillaceae bacterium Marseille-Q3522 tRNA-Ala
  60. Fervidibacillus albus tRNA-Ala
  61. Fervidibacillus halotolerans tRNA-Ala
  62. Mangrovibacillus cuniculi tRNA-Ala
  63. Bacillaceae bacterium SAOS 7 tRNA-Ala
  64. Bacillaceae bacterium SAS-127 tRNA-Ala
  65. Radiobacillus deserti tRNA-Ala
  66. Bacillaceae bacterium tRNA-Ala
  67. Caryophanales bacterium Bacillales bacterium tRNA-Ala
  68. Bacilli bacterium tRNA-Ala
  69. Bacillota bacterium tRNA-Ala
  70. Bacillus aerius tRNA-Ala
  71. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Ala
  72. Bacillus amyloliquefaciens CC178 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  73. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  74. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Ala
  75. Bacillus amyloliquefaciens IT-45 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  76. Bacillus amyloliquefaciens KHG19 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  77. Bacillus amyloliquefaciens LFB112 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  78. Bacillus amyloliquefaciens LL3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  79. Bacillus amyloliquefaciens TA208 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  80. Bacillus amyloliquefaciens tRNA-Ala
  81. Bacillus amyloliquefaciens UASWS BA1 tRNA-Ala
  82. Bacillus amyloliquefaciens UMAF6614 tRNA-Ala
  83. Bacillus amyloliquefaciens UMAF6639 tRNA-Ala
  84. Bacillus amyloliquefaciens XH7 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  85. Bacillus velezensis YAU B9601-Y2 tRNA-Ala
  86. Bacillus ayatagriensis tRNA-Ala
  87. Bacillus cabrialesii subsp. cabrialesii tRNA-Ala
  88. Bacillus cabrialesii subsp. tritici tRNA-Ala
  89. Bacillus cabrialesii tRNA-Ala
  90. Mesobacillus campisalis tRNA-Ala
  91. Bacillus canaveralius tRNA-Ala
  92. Bacillus carboniphilus tRNA-Ala
  93. Bacillus cereus tRNA-Ala
  94. Bacillus changyiensis tRNA-Ala
  95. Niallia circulans tRNA-Ala(tgc)
  96. Heyndrickxia coagulans P38 tRNA-Ala
  97. Bacillus coahuilensis m2-6 tRNA-Ala
  98. Bacillus coahuilensis p1.1.43 tRNA-Ala
  99. Bacillus coahuilensis tRNA-Ala
  100. Alkalicoccus daliensis tRNA_Ala_TGC
  101. [Bacillus] enclensis tRNA_Ala_TGC
  102. Niallia endozanthoxylica tRNA-Ala
  103. Bacillus firmis tRNA-Ala
  104. Cytobacillus firmus DS1 tRNA-Ala
  105. Bacillus freudenreichii tRNA-Ala(tgc)
  106. Lederbergia galactosidilytica tRNA-Ala
  107. Bacillus glycinifermentans tRNA-Ala
  108. Bacillus haikouensis tRNA-Ala
  109. Bacillus halotolerans tRNA-Ala
  110. Bacillus haynesii tRNA-Ala
  111. Bacillus inaquosorum tRNA-Ala(tgc)
  112. Bacillus infantis NRRL B-14911 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  113. Bacillus infantis tRNA-Ala
  114. Bacillus spizizenii tRNA-Ala
  115. Bacillus jepli tRNA-Ala
  116. Shouchella lehensis tRNA-Ala
  117. Bacillus licheniformis CG-B52 tRNA-Ala
  118. Bacillus [licheniformis] CMCC 63516 tRNA-Ala
  119. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  120. Bacillus licheniformis LMG 6934 tRNA-Ala
  121. Bacillus licheniformis tRNA-Ala(tgc)
  122. Bacillus licheniformis WX-02 tRNA-Ala
  123. Bacillus litorisediminis tRNA
  124. Bacillus lumedeiriae tRNA-Ala
  125. Rossellomorea marisflavi tRNA-Ala
  126. Priestia megaterium tRNA-Ala
  127. Bacillus methanolicus MGA3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  128. Bacillus methanolicus PB1 tRNA-Ala
  129. Bacillus methanolicus tRNA-Ala
  130. Bacillus mexicanus tRNA-Ala
  131. Bacillus mojavensis RO-H-1 = KCTC 3706 tRNA-Ala
  132. Bacillus mojavensis tRNA-Ala
  133. Bacillus nakamurai tRNA-Ala
  134. Neobacillus notoginsengisoli tRNA-Ala
  135. Bacillus obstructivus tRNA-Ala
  136. Cytobacillus oceanisediminis 2691 tRNA-Ala
  137. Halalkalibacterium halodurans tRNA-Ala
  138. Bacillus oleivorans tRNA-Ala
  139. Bacillus paralicheniformis ATCC 9945a tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  140. Bacillus paralicheniformis tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  141. Alkalihalobacillus pseudalcaliphilus tRNA-Ala
  142. Bacillus pumilus tRNA-Ala
  143. Bacillus rugosus tRNA-Ala
  144. Bacillus safensis tRNA-Ala
  145. [Bacillus] selenitireducens MLS10 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  146. Bacillus seohaeanensis tRNA-Ala
  147. Bacillus siamensis tRNA-Ala
  148. Bacillus smithii 7_3_47FAA tRNA-Ala
  149. Bacillus smithii tRNA-Ala
  150. Bacillus solimangrovi tRNA-Ala
  151. Bacillus songklensis tRNA-Ala
  152. Bacillus sonorensis L12 tRNA-Ala
  153. Bacillus sonorensis tRNA-Ala
  154. Bacillus sp. 1NLA3E tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  155. Bacillus sp. 1s-1 tRNA-Ala
  156. Bacillus sp. 2211 tRNA-Ala
  157. Bacillus sp. 22266 tRNA-Ala
  158. Bacillus sp. 22293 tRNA-Ala
  159. Bacillus sp. 275 tRNA-Ala
  160. Bacillus sp. 2_A_57_CT2 tRNA-Ala
  161. Bacillus sp. 2CMS4F tRNA-Ala
  162. Bacillus sp. 31 tRNA-Ala
  163. Siminovitchia acidinfaciens tRNA-Ala
  164. Bacillus sp. 349Y tRNA-Ala
  165. Bacillus sp. 3A_MP1 tRNA-Ala
  166. Bacillus sp. 4A_MP3 tRNA-Ala
  167. Bacillus sp. 5001 tRNA-Ala
  168. Bacillus sp. 5B6 tRNA-Ala
  169. Bacillus sp. 7520-S tRNA-Ala
  170. Bacillus sp. 7586-K tRNA-Ala
  171. Bacillus sp. 7894-2 tRNA-Ala
  172. Bacillus sp. 7D3 tRNA-Ala
  173. Bacillus sp. A053 tRNA-Ala
  174. Bacillus sp. A116_S68 tRNA-Ala
  175. Bacillus sp. A1 tRNA-Ala
  176. Bacillus sp. A301a_S52 tRNA-Ala
  177. Bacillus sp. AAVF1 tRNA-Ala
  178. Bacillus sp. AF42 tRNA-Ala
  179. Bacillus sp. AFS006103 tRNA-Ala
  180. Bacillus sp. AFS015802 tRNA-Ala
  181. Bacillus sp. AFS031507 tRNA-Ala
  182. Bacillus sp. AFS040349 tRNA-Ala
  183. Bacillus sp. AG1 tRNA-Ala
  184. Bacillus sp. AG4(2022) tRNA-Ala
  185. Bacillus sp. AK031 tRNA-Ala
  186. Bacillus sp. AK124 tRNA-Ala
  187. Bacillus sp. AK130 tRNA-Ala
  188. Bacillus sp. alh8 tRNA-Ala
  189. Bacillus sp. AM1(2019) tRNA-Ala
  190. Bacillus sp. AnS8 tRNA-Ala
  191. Bacillus sp. ANT_WA51 tRNA-Ala
  192. Bacillus sp. AR11 tRNA-Ala
  193. Bacillus sp. B1(2022) tRNA-Ala
  194. Bacillus sp. B15-48 tRNA-Ala
  195. Bacillus sp. B18(2022) tRNA-Ala
  196. Bacillus sp. B19-2 tRNA-Ala
  197. Bacillus sp. B2(2022) tRNA-Ala
  198. Bacillus sp. B28 tRNA-Ala
  199. Bacillus sp. B38 tRNA-Ala
  200. Bacillus sp. B8(2022) tRNA-Ala
  201. Bacillus sp. BACIII tRNA-Ala
  202. Bacillus sp. BAC tRNA-Ala
  203. Bacillus sp. BC1-43 tRNA-Ala
  204. Bacillus sp. BH072 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  205. Bacillus sp. BHET2 tRNA-Ala
  206. Bacillus sp. B-jedd tRNA-Ala
  207. Bacillus sp. BMG-18 tRNA-Ala
  208. Bacillus sp. BT1B_CT2 tRNA-Ala
  209. Bacillus sp. Bvel1 tRNA-Ala
  210. Bacillus sp. Bwzl_19 tRNA-Ala
  211. Bacillus sp. C10(2022) tRNA-Ala
  212. Bacillus sp. C11(2022) tRNA-Ala
  213. Bacillus sp. C1-1 tRNA-Ala
  214. Bacillus sp. C2(2022) tRNA-Ala
  215. Bacillus sp. C28GYM-DRY-1 tRNA-Ala
  216. Bacillus sp. C3(2022) tRNA-Ala
  217. Bacillus sp. C37plca tRNA-Ala
  218. Bacillus sp. C5(2022) tRNA-Ala
  219. Bacillus sp. CCNWLCWHY013 tRNA-Ala
  220. Bacillus sp. CH30_1T tRNA-Ala
  221. Bacillus sp. ChL18 tRNA-Ala
  222. Bacillus sp. CJ1 tRNA-Ala
  223. Bacillus sp. CMAA 1185 tRNA-Ala
  224. Bacillus sp. CMF12 tRNA-Ala
  225. Bacillus sp. CPSM8 tRNA-Ala
  226. Bacillus sp. CRN 9 tRNA-Ala
  227. Bacillus haimaensis Bacillus sp. CSS-39 tRNA-Ala
  228. Bacillus aerolatus tRNA-Ala
  229. Bacillus sp. D12 tRNA-Ala
  230. Bacillus sp. D7-8 tRNA-Ala
  231. Bacillus sp. DFI.2.34 tRNA-Ala
  232. Bacillus sp. DM2 tRNA-Ala
  233. Bacillus sp. DNRA2 tRNA-Ala
  234. Bacillus sp. DR8(2025) tRNA-Ala
  235. Metabacillus sediminilitoris tRNA-Ala
  236. Bacillus sp. DSM 27956 tRNA-Ala
  237. Bacillus sp. EB106-08-02-XG196 tRNA-Ala
  238. Bacillus sp. EKM208B tRNA-Ala
  239. Bacillus sp. EKM213B tRNA-Ala
  240. Bacillus sp. EKM417B tRNA-Ala
  241. Bacillus sp. EKM420B tRNA-Ala
  242. Bacillus sp. es.034 tRNA-Ala
  243. Bacillus sp. EU52 tRNA-Ala
  244. Bacillus sp. EU55 tRNA-Ala
  245. Bacillus sp. EU62 tRNA-Ala
  246. Bacillus sp. EU63 tRNA-Ala
  247. Bacillus sp. F1-12(2026) tRNA-Ala
  248. Bacillus sp. FJAT-14266 tRNA-Ala
  249. Bacillus sp. FJAT-18017 tRNA-Ala
  250. Bacillus sp. FJAT-27225 tRNA-Ala
  251. Bacillus sp. FJAT-27231 tRNA-Ala
  252. Bacillus sp. FJAT-27445 tRNA-Ala
  253. Bacillus sp. FJAT-27916 tRNA-Ala
  254. Bacillus sp. FJAT-27986 tRNA-Ala
  255. Bacillus sp. FJAT-29953 tRNA-Ala
  256. Bacillus sp. FJAT-49711 tRNA-Ala
  257. Bacillus sp. FJAT-49736 tRNA-Ala
  258. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Ala
  259. Bacillus sp. FMQ74 tRNA-Ala
  260. Bacillus sp. FSL E2-0174 tRNA-Ala
  261. Bacillus sp. FSL H8-0515 tRNA-Ala
  262. Bacillus sp. FSL K6-0036 tRNA-Ala
  263. Bacillus sp. FSL K6-0047 tRNA-Ala
  264. Bacillus sp. FSL K6-0138 tRNA-Ala
  265. Bacillus sp. FSL K6-0250 tRNA-Ala
  266. Bacillus sp. FSL K6-0255 tRNA-Ala
  267. Bacillus sp. FSL K6-0764 tRNA-Ala
  268. Bacillus sp. FSL K6-0947 tRNA-Ala
  269. Bacillus sp. FSL K6-0972 tRNA-Ala
  270. Bacillus sp. FSL K6-0993 tRNA-Ala
  271. Bacillus sp. FSL K6-0998 tRNA-Ala
  272. Bacillus sp. FSL K6-1003 tRNA-Ala
  273. Bacillus sp. FSL K6-1005 tRNA-Ala
  274. Bacillus sp. FSL K6-1012 tRNA-Ala
  275. Bacillus sp. FSL K6-1109 tRNA-Ala
  276. Bacillus sp. FSL K6-1234 tRNA-Ala
  277. Bacillus sp. FSL K6-1284 tRNA-Ala
  278. Bacillus sp. FSL K6-1366 tRNA-Ala
  279. Bacillus sp. FSL K6-1560 tRNA-Ala
  280. Bacillus sp. FSL K6-2819 tRNA-Ala
  281. Bacillus sp. FSL K6-2861 tRNA-Ala
  282. Bacillus sp. FSL K6-2865 tRNA-Ala
  283. Bacillus sp. FSL K6-3846 tRNA-Ala
  284. Bacillus sp. FSL K6-5915 tRNA-Ala
  285. Bacillus sp. FSL K6-6483 tRNA-Ala
  286. Bacillus sp. FSL K6-6540 tRNA-Ala
  287. Bacillus sp. FSL K6-8391 tRNA-Ala
  288. Bacillus sp. FSL L8-0173 tRNA-Ala
  289. Bacillus sp. FSL L8-0186 tRNA-Ala
  290. Bacillus sp. FSL L8-0193 tRNA-Ala
  291. Bacillus sp. FSL L8-0222 tRNA-Ala
  292. Bacillus sp. FSL L8-0358 tRNA-Ala
  293. Bacillus sp. FSL L8-0528 tRNA-Ala
  294. Bacillus sp. FSL M7-0417 tRNA-Ala
  295. Bacillus sp. FSL M7-1004 tRNA-Ala
  296. Bacillus sp. FSL M8-0025 tRNA-Ala
  297. Bacillus sp. FSL M8-0052 tRNA-Ala
  298. Bacillus sp. FSL M8-0054 tRNA-Ala
  299. Bacillus sp. FSL M8-0071 tRNA-Ala
  300. Bacillus sp. FSL M8-0133 tRNA-Ala
  301. Bacillus sp. FSL M8-0168 tRNA-Ala
  302. Bacillus sp. FSL M8-0315 tRNA-Ala
  303. Bacillus sp. FSL M8-0359 tRNA-Ala
  304. Bacillus sp. FSL P2-0026 tRNA-Ala
  305. Bacillus sp. FSL P4-0290 tRNA-Ala
  306. Bacillus sp. FSL P4-0334 tRNA-Ala
  307. Bacillus sp. FSL R5-0394 tRNA-Ala
  308. Bacillus sp. FSL R5-0416 tRNA-Ala
  309. Bacillus sp. FSL R5-0418 tRNA-Ala
  310. Bacillus sp. FSL R5-0434 tRNA-Ala
  311. Bacillus sp. FSL R5-0443 tRNA-Ala
  312. Bacillus sp. FSL R5-0447 tRNA-Ala
  313. Bacillus sp. FSL R5-0523 tRNA-Ala
  314. Bacillus sp. FSL R5-0560 tRNA-Ala
  315. Bacillus sp. FSL R5-0576 tRNA-Ala
  316. Bacillus sp. FSL R5-0593 tRNA-Ala
  317. Bacillus sp. FSL R5-0603 tRNA-Ala
  318. Bacillus sp. FSL R7-0646 tRNA-Ala
  319. Bacillus sp. FSL R7-0685 tRNA-Ala
  320. Bacillus sp. FSL R7-0718 tRNA-Ala
  321. Bacillus sp. FSL W7-1092 tRNA-Ala
  322. Bacillus sp. FSL W7-1282 tRNA-Ala
  323. Bacillus sp. FSL W7-1321 tRNA-Ala
  324. Bacillus sp. FSL W7-1354 tRNA-Ala
  325. Bacillus sp. FSL W7-1360 tRNA-Ala
  326. Bacillus sp. FSL W8-0102 tRNA-Ala
  327. Bacillus sp. FSL W8-0116 tRNA-Ala
  328. Bacillus sp. FSL W8-0223 tRNA-Ala
  329. Bacillus sp. FSL W8-0445 tRNA-Ala
  330. Bacillus sp. FSL W8-0812 tRNA-Ala
  331. Bacillus sp. FSL W8-0848 tRNA-Ala
  332. Bacillus sp. FSL W8-0940 tRNA-Ala
  333. Bacillus sp. FSL W8-1122 tRNA-Ala
  334. Bacillus sp. FSL W8-1127 tRNA-Ala
  335. Bacillus sp. FSL W8-1202 tRNA-Ala
  336. Bacillus sp. FW1 tRNA-Ala
  337. Bacillus sp. G16 tRNA-Ala
  338. Bacillus sp. GM1 tRNA-Ala
  339. Bacillus sp. GM2 tRNA-Ala
  340. Bacillus sp. GZB tRNA-Ala
  341. Bacillus sp. H15-1 tRNA-Ala
  342. Bacillus sp. H1F1 tRNA-Ala
  343. Bacillus sp. H2FL2 tRNA-Ala
  344. Bacillus sp. HB022 tRNA-Ala
  345. Exobacillus caeni tRNA-Ala
  346. Bacillus sp. Hm123 tRNA-Ala
  347. Bacillus sp. HN03 tRNA-Ala
  348. Bacillus sp. HNA3 tRNA-Ala
  349. Bacillus sp. HNG tRNA-Ala
  350. Bacillus sp. HSf4 tRNA-Ala
  351. Bacillus sp. ICE1 tRNA-Ala
  352. Bacillus sp. IG2 tRNA-Ala
  353. Bacillus sp. IG6 tRNA-Ala
  354. Bacillus sp. IITD106 tRNA-Ala
  355. Bacillus sp. (in: firmicutes) (in: firmicutes) tRNA-Ala
  356. Bacillus sp. IS1 tRNA-Ala
  357. Bacillus sp. ISL-40 tRNA-Ala
  358. Bacillus sp. ISL-46 tRNA-Ala
  359. Bacillus sp. ISL-47 tRNA-Ala
  360. Bacillus sp. ISL-77 tRNA-Ala
  361. Bacillus sp. ISL-7 tRNA-Ala
  362. Bacillus sp. IT-13CA1 tRNA-Ala
  363. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Ala
  364. Bacillus spizizenii str. W23 tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  365. Bacillus spizizenii tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1, tRNA-Ala-TGC-2-2)
  366. Bacillus spizizenii TU-B-10 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  367. Bacillus sp. J14 tRNA-Ala
  368. Bacillus sp. J14TS2 tRNA-Ala
  369. Bacillus sp. J41TS8 tRNA-Ala
  370. Bacillus sp. J5TS4 tRNA-Ala
  371. Bacillus sp. JHAA tRNA-Ala
  372. Sutcliffiella rhizosphaerae tRNA-Ala
  373. Bacillus sp. JJ1533 tRNA-Ala
  374. Bacillus sp. JJ1562 tRNA-Ala
  375. Bacillus sp. JK106 tRNA-Ala
  376. Bacillus sp. JK127 tRNA-Ala
  377. Bacillus sp. JK62 tRNA-Ala
  378. Bacillus sp. JK74 tRNA-Ala
  379. Bacillus sp. JNUCC-21 tRNA-Ala
  380. Bacillus sp. JNUCC-22 tRNA-Ala
  381. Bacillus sp. JRC01 tRNA-Ala
  382. Bacillus sp. JS tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  383. Bacillus sp. jun1 tRNA-Ala
  384. Bacillus sp. jun7 tRNA-Ala
  385. Bacillus sp. JZ109 tRNA-Ala
  386. Bacillus sp. JZ34 tRNA-Ala
  387. Bacillus sp. JZ39 tRNA-Ala
  388. Bacillus sp. JZ76 tRNA-Ala
  389. Bacillus sp. JZ78 tRNA-Ala
  390. Bacillus sp. K7 tRNA-Ala
  391. Bacillus sp. KBS0812 tRNA-Ala
  392. Bacillus sp. KeR2 tRNA-Ala
  393. Bacillus sp. KH172YL63 tRNA-Ala
  394. Bacillus sp. KICET-1 tRNA-Ala
  395. Bacillus sp. KICET-3 tRNA-Ala
  396. Alteribacter keqinensis tRNA-Ala
  397. Bacillus sp. KS1 tRNA-Ala
  398. Bacillus sp. L381 tRNA-Ala
  399. Bacillus sp. LB7 tRNA-Ala
  400. Bacillus sp. LBG-1-113 tRNA-Ala
  401. Bacillus sp. Leaf406 tRNA-Ala
  402. Neobacillus massiliamazoniensis tRNA-Ala
  403. Bacillus sp. LJBS06 tRNA-Ala
  404. Bacillus sp. LJBS17 tRNA-Ala
  405. Bacillus sp. LJBV19 tRNA-Ala
  406. Bacillus sp. LK7 tRNA-Ala
  407. Bacillus sp. LM 4-2 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  408. Bacillus sp. LMB3902 tRNA-Ala
  409. Bacillus sp. LMT tRNA-Ala
  410. Bacillus sp. LR--39 tRNA-Ala
  411. Bacillus sp. LUNF1 tRNA-Ala
  412. Bacillus sp. LYLB4 tRNA-Ala
  413. Bacillus velezensis tRNA-Ala
  414. Alteribacter natronophilus Bacillus sp. M30 tRNA-Ala
  415. Paenalkalicoccus suaedae tRNA-Ala
  416. Bacillus sp. Man122 tRNA-Ala
  417. Bacillus sp. MBGLi97 tRNA-Ala
  418. Bacillus sp. MD-5 tRNA-Ala
  419. Bacillus sp. MFK14 tRNA-Ala
  420. Bacillus sp. MFK6 tRNA-Ala
  421. Bacillus sp. MKU004 tRNA-Ala
  422. Bacillus sp. MM2020_1 tRNA-Ala
  423. Bacillus sp. MM2020_4 tRNA-Ala
  424. Bacillus sp. MRMR6 tRNA-Ala
  425. Bacillus sp. MT(2024) tRNA-Ala
  426. Bacillus sp. MT tRNA-Ala
  427. Bacillus sp. N13C7 tRNA-Ala
  428. Cytobacillus sp. NCCP-133 tRNA-Ala
  429. Bacillus sp. NEAU-16 tRNA-Ala
  430. Bacillus sp. NEAU-242-2 tRNA-Ala
  431. Bacillus sp. NIO_002 tRNA-Ala
  432. Bacillus sp. NTK034 tRNA-Ala
  433. Bacillus sp. NTK074B tRNA-Ala
  434. Bacillus sp. OAE578 tRNA-Ala
  435. Bacillus sp. OG2 tRNA-Ala
  436. Bacillus spongiae tRNA-Ala
  437. Bacillus sp. PAMC26543 tRNA-Ala
  438. Bacillus sp. PAMC28748 tRNA-Ala
  439. Bacillus sp. Pc3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  440. Bacillus sp. PCH94 tRNA-Ala
  441. Bacillus sp. PK3-037 tRNA-Ala
  442. Bacillus sp. PK3-130 tRNA-Ala
  443. Bacillus sp. PK3-136 tRNA-Ala
  444. Bacillus sp. PK3_68 tRNA-Ala
  445. Bacillus sp. PK6-013 tRNA-Ala
  446. Bacillus sp. PK6-025 tRNA-Ala
  447. Bacillus sp. PK6-026 tRNA-Ala
  448. Bacillus sp. PM43 tRNA-Ala
  449. Bacillus sp. PM8313 tRNA-Ala
  450. Bacillus sp. PS108 tRNA-Ala
  451. Bacillus sp. PS11(2022) tRNA-Ala
  452. Bacillus sp. PS18 tRNA-Ala
  453. Bacillus sp. PS194 tRNA-Ala
  454. Bacillus sp. PS196 tRNA-Ala
  455. Bacillus sp. PS20 tRNA-Ala
  456. Bacillus sp. PS210 tRNA-Ala
  457. Bacillus sp. PS217 tRNA-Ala
  458. Bacillus sp. PS237 tRNA-Ala
  459. Bacillus sp. PS65 tRNA-Ala
  460. Bacillus sp. PS68 tRNA-Ala
  461. Bacillus sp. PS93 tRNA-Ala
  462. Bacillus sp. PS95 tRNA-Ala
  463. Bacillus sp. R45 tRNA-Ala
  464. Bacillus sp. RHF6 tRNA-Ala
  465. Bacillus sp. RHFS10 tRNA-Ala
  466. Bacillus sp. RHFS18 tRNA-Ala
  467. Bacillus sp. RO1 tRNA-Ala
  468. Bacillus sp. RO2 tRNA-Ala
  469. Bacillus sp. RO3 tRNA-Ala
  470. Bacillus sp. Ru63 tRNA-Ala
  471. Bacillus sp. S10C12M tRNA-Ala
  472. Bacillus sp. S17B2 tRNA-Ala
  473. Bacillus sp. S20C3 tRNA-Ala
  474. Bacillus sp. S3 tRNA-Ala
  475. Bacillus sp. SA1-12 tRNA-Ala
  476. Bacillus sp. SA116 tRNA-Ala
  477. Bacillus norwichensis tRNA-Ala
  478. Bacillus sp. SAJ1 tRNA-Ala
  479. Bacillus sp. SB49 tRNA-Ala
  480. Bacillus sp. SD088 tRNA-Ala
  481. Bacillus sp. SDLI1 tRNA-Ala
  482. Bacillus sp. SG20032 tRNA-Ala
  483. Bacillus sp. SG20033 tRNA-Ala
  484. Bacillus sp. SIMBA_006 tRNA-Ala
  485. Bacillus sp. SIMBA_008 tRNA-Ala
  486. Bacillus sp. SIMBA_026 tRNA-Ala
  487. Bacillus sp. SIMBA_031 tRNA-Ala
  488. Bacillus sp. SIMBA_033 tRNA-Ala
  489. Bacillus sp. SKDU12 tRNA-Ala
  490. Bacillus salacetis tRNA-Ala
  491. Bacillus sp. SL112 tRNA-Ala
  492. Bacillus sp. SLBN-46 tRNA-Ala
  493. Bacillus sp. SLBN-57 tRNA-Ala
  494. Bacillus sp. SN1 tRNA-Ala
  495. Bacillus sp. SN32 tRNA-Ala
  496. Bacillus sp. SORGH_AS_0510 tRNA-Ala
  497. Bacillus sp. SPARC3 tRNA-Ala
  498. Paenibacillus sp. PL91 tRNA-Ala
  499. Bacillus paralicheniformis tRNA-Ala
  500. Bacillus sp. SW14 tRNA-Ala
  501. Bacillus sp. T17B1 tRNA-Ala
  502. Bacillus sp. T2-22 tRNA-Ala
  503. Bacillus sp. T33-2 tRNA-Ala
  504. Bacillus sp. T9C1 tRNA-Ala
  505. Bacillus sp. THAF10 tRNA-Ala
  506. Bacillus sp. TS-2 tRNA-Ala
  507. Bacillus sp. TSA-4 tRNA-Ala
  508. Bacillus sp. UMB0728 tRNA-Ala
  509. Bacillus sp. UMB0899 tRNA-Ala
  510. Bacillus sp. V26 tRNA-Ala
  511. Bacillus sp. V3-13 tRNA-Ala
  512. Bacillus sp. V33-4 tRNA-Ala
  513. Bacillus sp. V3 tRNA-Ala
  514. Bacillus sp. VT-16-64 tRNA-Ala
  515. Bacillus sp. WMMC1349 tRNA-Ala
  516. Bacillus sp. WR11 tRNA-Ala
  517. Bacillus sp. WR12 tRNA-Ala
  518. Bacillus sp. WR13 tRNA-Ala
  519. Bacillus sp. X1(2014) tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  520. Bacillus sp. X2(2017) (2017) tRNA-Ala
  521. Bacillus sp. XT-2 tRNA-Ala
  522. Bacillus sp. XZ-5 tRNA-Ala
  523. Bacillus sp. YAF8 tRNA-Ala
  524. Bacillus sp. YBsi01 tRNA-Ala
  525. Bacillus sp. YH3-2-B2 tRNA-Ala
  526. Neobacillus piezotolerans tRNA-Ala
  527. Bacillus sp. YP1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  528. Alteribacter lacisalsi tRNA-Ala
  529. Bacillus sp. z60-10 tRNA-Ala
  530. Bacillus sp. z60-11 tRNA-Ala
  531. Bacillus sp. z60-18 tRNA-Ala
  532. Bacillus sp. ZCB01 tRNA-Ala
  533. Bacillus sp. ZHX3 tRNA-Ala
  534. Bacillus sp. ZY-1-1 tRNA-Ala
  535. Bacillus sp. ZZV12-4809 tRNA-Ala
  536. Bacillus stercoris tRNA-Ala
  537. Mesobacillus subterraneus tRNA-Ala
  538. Bacillus subtilis BEST7003 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  539. Bacillus subtilis BEST7613 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  540. Bacillus subtilis BSn5 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  541. Bacillus subtilis HJ5 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  542. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  543. Bacillus subtilis PY79 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  544. Bacillus subtilis QB928 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  545. Bacillus subtilis QH-1 tRNA-Ala
  546. Bacillus subtilis subsp. natto BEST195 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  547. Bacillus subtilis subsp. natto tRNA-Ala
  548. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  549. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Ala
  550. Bacillus subtilis subsp. subtilis str. 168 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  551. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  552. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 9)
  553. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  554. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  555. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  556. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  557. Bacillus subtilis subsp. subtilis str. SMY tRNA-Ala
  558. Bacillus subtilis subsp. subtilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  559. Bacillus subtilis TO-A tRNA-Ala
  560. Bacillus subtilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 6)
  561. Bacillus subtilis XF-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  562. Bacillus swezeyi tRNA-Ala
  563. Bacillus taeanensis tRNA-Ala
  564. Bacillus tequilensis tRNA-Ala(tgc)
  565. Bacillus thuringiensis HD1002 tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1)
  566. Bacillus thuringiensis HD-789 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  567. Bacillus thuringiensis serovar israelensis tRNA-Ala(tgc)
  568. Bacillus thuringiensis serovar novosibirsk tRNA-Ala
  569. Bacillus thuringiensis tRNA-Ala
  570. Bacillus timonensis tRNA-Ala
  571. Alkalihalobacillus trypoxylicola tRNA-Ala
  572. Alkalicoccus urumqiensis tRNA-Ala
  573. Bacillus vallismortis tRNA-Ala
  574. Bacillus velezensis AS43.3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  575. Bacillus velezensis CAU B946 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  576. Bacillus velezensis FZB42 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  577. Bacillus velezensis NAU-B3 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  578. Bacillus velezensis NJN-6 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  579. Bacillus velezensis SQR9 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  580. Bacillus velezensis TrigoCor1448 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  581. Bacillus velezensis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 7)
  582. Bacillus velezensis UCMB5033 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  583. Bacillus velezensis UCMB5036 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  584. Bacillus velezensis UCMB5113 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  585. Bacillus velezensis YAU B9601-Y2 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  586. Rossellomorea vietnamensis tRNA-Ala
  587. Heyndrickxia vini tRNA-Ala
  588. Metabacillus harenarius tRNA-Ala
  589. Pseudobacillus wudalianchiensis tRNA-Ala
  590. Bhargavaea beijingensis tRNA_Ala_TGC
  591. Bhargavaea cecembensis DSE10 tRNA-Ala
  592. Bhargavaea cecembensis tRNA-Ala
  593. Bhargavaea changchunensis tRNA-Ala
  594. Bhargavaea ullalensis tRNA-Ala
  595. Brevibacillus laterosporus tRNA-Ala
  596. Caldibacillus thermoamylovorans tRNA-Ala
  597. Caldifermentibacillus hisashii tRNA-Ala
  598. Candidatus Absconditabacterales bacterium tRNA-Ala
  599. Candidatus Erysipelatoclostridium merdavium tRNA-Ala
  600. Candidatus Izemoplasmataceae bacterium tRNA-Ala
  601. Chondromyces sp. tRNA-Ala
  602. Clostridium faecium tRNA-Ala
  603. Compostibacillus humi tRNA-Ala
  604. compost metagenome tRNA-Ala
  605. Coprobacillaceae bacterium CR2/5/TPMF4 tRNA-Ala
  606. Crossiella cryophila tRNA-Ala
  607. Cutibacterium acnes tRNA-Ala
  608. Cyanobacterium aponinum 0216 tRNA-Ala
  609. Cytobacillus firmus tRNA-Ala
  610. Cytobacillus horneckiae tRNA-Ala
  611. Cytobacillus kochii tRNA-Ala
  612. Cytobacillus oceanisediminis tRNA-Ala(tgc)
  613. Cytobacillus pseudoceanisediminis tRNA-Ala(tgc)
  614. Cytobacillus purgationiresistens tRNA-Ala
  615. Cytobacillus sp. ABV4_503 tRNA-Ala
  616. Cytobacillus sp. AMY 15.2 tRNA-Ala
  617. Cytobacillus sp. BC1816 tRNA-Ala
  618. Cytobacillus sp. C11.1 tRNA-Ala
  619. Cytobacillus sp. EB106-05-05-XG126 tRNA-Ala
  620. Cytobacillus sp. FSL H8-0458 tRNA-Ala
  621. Cytobacillus sp. FSL K6-0129 tRNA-Ala
  622. Cytobacillus sp. FSL K6-0265 tRNA-Ala
  623. Cytobacillus sp. FSL M8-0252 tRNA-Ala
  624. Cytobacillus sp. FSL R5-0377 tRNA-Ala
  625. Cytobacillus sp. FSL R5-0569 tRNA-Ala
  626. Cytobacillus sp. FSL R5-0596 tRNA-Ala
  627. Cytobacillus sp. FSL R7-0680 tRNA-Ala
  628. Cytobacillus sp. FSL R7-0696 tRNA-Ala
  629. Cytobacillus sp. FSL W7-1323 tRNA-Ala
  630. Cytobacillus sp. FSL W8-0315 tRNA-Ala
  631. Cytobacillus sp. NJ13 tRNA-Ala
  632. Cytobacillus sp. OWB-43 tRNA-Ala
  633. Cytobacillus sp. QJM3NY_8 tRNA-Ala
  634. Cytobacillus stercorigallinarum tRNA-Ala
  635. Cytobacillus sp. SAFR-174 tRNA-Ala
  636. Cytobacillus sp. T106 tRNA-Ala
  637. Domibacillus aminovorans tRNA-Ala
  638. Domibacillus epiphyticus tRNA-Ala
  639. Domibacillus indicus tRNA-Ala
  640. Domibacillus iocasae tRNA-Ala
  641. Domibacillus sp. 8LH tRNA-Ala
  642. Domibacillus sp. A3M-37 tRNA-Ala
  643. Domibacillus sp. DTU_2020_1001157_1_SI_ALB_TIR_016 tRNA-Ala
  644. Domibacillus sp. PGB-M46 tRNA-Ala
  645. Ectobacillus funiculus tRNA-Ala
  646. Ectobacillus ponti tRNA-Ala
  647. Ectobacillus sp. OTK tRNA-Ala
  648. Ectobacillus sp. tRNA-Ala
  649. Embleya sp. NPDC055664 tRNA-Ala
  650. Embleya sp. NPDC056538 tRNA-Ala
  651. Embleya sp. NPDC056575 tRNA-Ala
  652. Embleya sp. NPDC059237 tRNA-Ala
  653. Enterococcus faecalis tRNA-Ala(tgc)
  654. Enterococcus faecium tRNA-Ala
  655. Erysipelatoclostridium sp. An15 tRNA-Ala
  656. Erysipelatoclostridium sp. An173 tRNA-Ala
  657. Escherichia coli tRNA-Ala
  658. [Eubacterium] sulci tRNA-Ala
  659. Evansella sp. AB-P1 tRNA-Ala
  660. Exiguobacterium sp. tRNA-Ala
  661. Falsibacillus albus tRNA-Ala
  662. Ferdinandcohnia sp. SAFN-114 tRNA-Ala
  663. Fictibacillus sp. Mic-4 tRNA-Ala
  664. Filobacillus milosensis tRNA-Ala
  665. Fredinandcohnia sp. FSL W7-1320 tRNA-Ala
  666. Fredinandcohnia sp. QZ13 tRNA-Ala
  667. Gemella bergeri ATCC 700627 tRNA-Ala
  668. Gemella bergeri tRNA-Ala
  669. Gemella haemolysans M341 tRNA-Ala
  670. Gemella haemolysans tRNA-Ala(tgc)
  671. Gemella morbillorum M424 tRNA-Ala
  672. Gemella morbillorum tRNA-Ala(tgc)
  673. Gemella parahaemolysans tRNA-Ala
  674. Gemella sanguinis M325 tRNA-Ala
  675. Gemella sanguinis tRNA-Ala(tgc)
  676. Gemella sp. 19428wG2_WT2a tRNA-Ala
  677. Gemella sp. 20925_1_85 tRNA-Ala
  678. Gemella sp. 27098_8_149 tRNA-Ala
  679. Gemella sp. 27098_8_155 tRNA-Ala
  680. Gemella sp. 27098_8_92 tRNA-Ala
  681. Gemella sp. GL1.1 tRNA-Ala
  682. Gemella sp. GL1 tRNA-Ala
  683. Gemella sp. Musashino-2025 tRNA-Ala
  684. Gemella sp. ND 6198 tRNA-Ala
  685. Gemella sp. oral taxon 928 tRNA-Ala
  686. Gemella sp. tRNA-Ala
  687. Gemella sp. WT2a tRNA-Ala
  688. Gemella taiwanensis tRNA-Ala
  689. Geomicrobium sediminis tRNA-Ala
  690. Geomicrobium sp. JSM 1781026 tRNA-Ala
  691. Gracilibacillus alcaliphilus tRNA-Ala
  692. Gracilibacillus boraciitolerans tRNA-Ala
  693. Gracilibacillus halotolerans tRNA-Ala
  694. Gracilibacillus marinus tRNA-Ala
  695. Gracilibacillus pellucidus tRNA-Ala
  696. Gracilibacillus sp. D59 tRNA-Ala
  697. Gracilibacillus sp. HCP3S3_G5_1 tRNA-Ala
  698. Gracilibacillus sp. HCP3S3_G5_2 tRNA-Ala
  699. Gracilibacillus sp. JCM 18860 tRNA-Ala
  700. Gracilibacillus sp. JCM 18966 tRNA-Ala
  701. Gracilibacillus salitolerans tRNA-Ala
  702. Gracilibacillus salinarum tRNA-Ala
  703. Gracilibacillus caseinilyticus tRNA-Ala
  704. Gracilibacillus oryzae tRNA-Ala
  705. Gracilibacillus thailandensis tRNA-Ala
  706. Gracilibacillus xinjiangensis tRNA-Ala
  707. Haemophilus influenzae tRNA-Ala
  708. Halalkalibacillus sediminis tRNA-Ala
  709. Halalkalibacterium halodurans C-125 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 5)
  710. Halalkalibacterium halodurans tRNA-Ala
  711. Halalkalibacter sp. AB-rgal2 tRNA-Ala
  712. Halalkalibacter sp. APA_J-10(15) tRNA-Ala
  713. Halobacillaceae bacterium ABV2_076 tRNA-Ala
  714. Halobacillus andaensis tRNA-Ala
  715. Halobacillus campisalis tRNA-Ala
  716. Halobacillus dabanensis tRNA_Ala_TGC
  717. Halobacillus halophilus DSM 2266 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  718. Halobacillus halophilus tRNA-Ala
  719. Halobacillus karajensis tRNA-Ala
  720. Halobacillus kuroshimensis tRNA-Ala
  721. Halobacillus litoralis tRNA-Ala
  722. Halobacillus locisalis tRNA-Ala
  723. Halobacillus mangrovi tRNA-Ala
  724. Halobacillus naozhouensis tRNA-Ala
  725. Halobacillus profundi tRNA-Ala
  726. Halobacillus salinus tRNA-Ala
  727. Halobacillus seohaensis tRNA-Ala
  728. Halobacillus sp. A1-3 tRNA-Ala
  729. Halobacillus sp. A1 tRNA-Ala
  730. Halobacillus sp. A5 tRNA-Ala
  731. Halobacillus sp. ABA4_118 tRNA-Ala
  732. Halobacillus sp. ABD4_316 tRNA-Ala
  733. Halobacillus sp. ABH2_015 tRNA-Ala
  734. Halobacillus sp. ABR2_026 tRNA-Ala
  735. Halobacillus sp. ACCC02827 tRNA-Ala
  736. Halobacillus sp. AWH4_228 tRNA-Ala
  737. Halobacillus sp. AWM4_238 tRNA-Ala
  738. Halobacillus sp. B23F22_1 tRNA-Ala
  739. Halobacillus sp. B23F22_5 tRNA-Ala
  740. Halobacillus sp. B29 tRNA-Ala
  741. Halobacillus sp. BBL2006 tRNA-Ala
  742. Halobacillus sp. FAM 114 tRNA-Ala
  743. Halobacillus sp. FAM 115 tRNA-Ala
  744. Halobacillus sp. GSS1 tRNA-Ala
  745. Halobacillus sp. H74 tRNA-Ala
  746. Halobacillus sp. HZG1 tRNA-Ala
  747. Halobacillus sp. IS-Hb2 tRNA-Ala
  748. Halobacillus sp. K22 tRNA-Ala
  749. Halobacillus yeomjeoni tRNA-Ala
  750. Halobacillus sp. MO56 tRNA-Ala
  751. Halobacillus sp. Nhm2S1 tRNA-Ala
  752. Halobacillus fulvus tRNA-Ala
  753. Halobacillus salinarum tRNA-Ala
  754. Halobacillus amylolyticus tRNA-Ala
  755. Halobacillus shinanisalinarum tRNA-Ala
  756. Halobacillus sp. SY10 tRNA-Ala
  757. Halobacillus trueperi tRNA-Ala
  758. Halobacillus yeomjeoni tRNA-Ala
  759. Halolactibacillus alkaliphilus tRNA_Ala_TGC
  760. Halolactibacillus halophilus tRNA-Ala
  761. Halolactibacillus miurensis tRNA-Ala
  762. Halomonas urumqiensis tRNA-Ala
  763. Halotalea alkalilenta tRNA-Ala
  764. Heyndrickxia acidicola tRNA-Ala
  765. Heyndrickxia camelliae tRNA-Ala
  766. Heyndrickxia coagulans 2-6 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  767. Heyndrickxia coagulans 36D1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  768. Heyndrickxia coagulans DSM 1 = ATCC 7050 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  769. Heyndrickxia coagulans tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  770. Heyndrickxia faecalis tRNA-Ala
  771. Heyndrickxia ginsengihumi tRNA-Ala
  772. Heyndrickxia oleronia tRNA-Ala
  773. Heyndrickxia shackletonii tRNA-Ala
  774. Heyndrickxia sp. FSL K6-6286 tRNA-Ala
  775. Heyndrickxia sp. FSL W8-0423 tRNA-Ala
  776. Heyndrickxia sp. FSL W8-0496 tRNA-Ala
  777. Heyndrickxia sp. FW510-T9 tRNA-Ala
  778. Heyndrickxia sp. NPDC080065 tRNA-Ala
  779. Heyndrickxia sporothermodurans tRNA-Ala
  780. Isoptericola sp. NPDC056573 tRNA-Ala
  781. Kitasatospora purpeofusca tRNA-Ala
  782. Kitasatospora sp. NPDC054939 tRNA-Ala
  783. Kitasatospora sp. NPDC056184 tRNA-Ala
  784. Kitasatospora sp. NPDC056651 tRNA-Ala
  785. Kitasatospora sp. NPDC057692 tRNA-Ala
  786. Kitasatospora sp. NPDC057904 tRNA-Ala
  787. Kitasatospora sp. NPDC057940 tRNA-Ala
  788. Kitasatospora sp. NPDC058162 tRNA-Ala
  789. Kitasatospora sp. NPDC058170 tRNA-Ala
  790. Kitasatospora sp. NPDC059462 tRNA-Ala
  791. Klebsiella pneumoniae tRNA-Ala
  792. Lactococcus lactis tRNA sequence
  793. Lederbergia citrisecunda tRNA-Ala
  794. Lederbergia citri tRNA-Ala
  795. Lederbergia panacisoli tRNA-Ala
  796. Lederbergia ruris tRNA-Ala
  797. Lederbergia sp. NSJ-179 tRNA-Ala
  798. Leeuwenhoekiella sp. tRNA-Ala
  799. Lentibacillus juripiscarius tRNA-Ala
  800. Lentibacillus populi tRNA-Ala
  801. Lentibacillus salinarum tRNA-Ala
  802. Lentibacillus sp. CBA3610 tRNA-Ala
  803. Lentibacillus sp. L22 tRNA-Ala
  804. Lentibacillus songyuanensis Lentibacillus sp. N15 tRNA-Ala
  805. Lentibacillus cibarius tRNA-Ala
  806. Lentibacillus cibarius tRNA-Ala
  807. Lentibacillus lipolyticus tRNA-Ala
  808. Liberiplasma polymorphum tRNA-Ala
  809. Listeria aquatica FSL S10-1188 tRNA-Ala
  810. Listeria aquatica tRNA-Ala
  811. Listeria booriae tRNA-Ala(tgc)
  812. Listeriaceae bacterium FSL A5-0209 tRNA-Ala
  813. Listeria cornellensis FSL F6-0969 tRNA-Ala
  814. Listeria cossartiae subsp. cayugensis tRNA-Ala
  815. Listeria farberi tRNA
  816. Listeria fleischmannii FSL S10-1203 tRNA-Ala
  817. Listeria fleischmannii subsp. coloradonensis tRNA-Ala(tgc)
  818. Listeria fleischmannii subsp. fleischmannii LU2006-1 tRNA-Ala
  819. Listeria fleischmannii subsp. fleischmannii tRNA-Ala(tgc)
  820. Listeria fleischmannii tRNA-Ala
  821. Listeria floridensis FSL S10-1187 tRNA-Ala
  822. Listeria grandensis FSL F6-0971 tRNA-Ala
  823. Listeria grandensis tRNA-Ala
  824. Listeria grayi FSL F6-1183 tRNA-Ala
  825. Listeria grayi tRNA-Ala(tgc)
  826. Listeria innocua Clip11262 transfert RNA-Ala
  827. Listeria innocua tRNA-Ala(tgc)
  828. Listeria ivanovii Ala-tRNA
  829. Listeria ivanovii subsp. ivanovii PAM 55 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  830. Listeria ivanovii subsp. ivanovii tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  831. Listeria ivanovii subsp. londoniensis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  832. Listeria ivanovii WSLC3009 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  833. Listeria kieliensis tRNA-Ala
  834. Listeria marthii tRNA-Ala
  835. Listeria monocytogenes 07PF0776 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  836. Listeria monocytogenes 08-5578 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  837. Listeria monocytogenes 08-5923 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  838. Listeria monocytogenes 10403S tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  839. Listeria monocytogenes 4423 tRNA-Ala
  840. Listeria monocytogenes 6179 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  841. Listeria monocytogenes ATCC 19115 tRNA-Ala
  842. Listeria monocytogenes ATCC 19117 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  843. Listeria monocytogenes CC70B tRNA-Ala
  844. Listeria monocytogenes CFSAN002184 tRNA-Ala
  845. Listeria monocytogenes CFSAN002191 tRNA-Ala
  846. Listeria monocytogenes CFSAN002202 tRNA-Ala
  847. Listeria monocytogenes CFSAN002208 tRNA-Ala
  848. Listeria monocytogenes CFSAN002349 tRNA-Ala
  849. Listeria monocytogenes CFSAN002351 tRNA-Ala
  850. Listeria monocytogenes CFSAN002355 tRNA-Ala
  851. Listeria monocytogenes CFSAN002357 tRNA-Ala
  852. Listeria monocytogenes CFSAN003811 tRNA-Ala
  853. Listeria monocytogenes CFSAN003824 tRNA-Ala
  854. Listeria monocytogenes CFSAN003825 tRNA-Ala
  855. Listeria monocytogenes EGD-e transfert RNA-Ala
  856. Listeria monocytogenes EGD tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  857. Listeria monocytogenes Finland 1998 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  858. Listeria monocytogenes FSL F6-684 tRNA-Ala
  859. Listeria monocytogenes FSL J1-175 tRNA-Ala
  860. Listeria monocytogenes FSL J1-208 tRNA-Ala
  861. Listeria monocytogenes FSL R2-561 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  862. Listeria monocytogenes HCC23 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  863. Listeria monocytogenes J0161 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  864. Listeria monocytogenes J1-220 tRNA-Ala
  865. Listeria monocytogenes J1816 tRNA-Ala
  866. Listeria monocytogenes L312 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  867. Listeria monocytogenes L99 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  868. Listeria monocytogenes LIS0063 tRNA-Ala
  869. Listeria monocytogenes LIS0077 tRNA-Ala
  870. Listeria monocytogenes LO28 tRNA-Ala
  871. Listeria monocytogenes M7 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  872. Listeria monocytogenes N53-1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  873. Listeria monocytogenes QOC1 tRNA-Ala
  874. Listeria monocytogenes QOC2 tRNA-Ala
  875. Listeria monocytogenes R479a tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  876. Listeria monocytogenes serotype 1/2a str. 02-5993 tRNA-Ala
  877. Listeria monocytogenes serotype 1/2a str. 04-5457 tRNA-Ala
  878. Listeria monocytogenes serotype 1/2a str. 08-6056 tRNA-Ala
  879. Listeria monocytogenes serotype 1/2a str. 08-6569 tRNA-Ala
  880. Listeria monocytogenes serotype 1/2a str. 08-6997 tRNA-Ala
  881. Listeria monocytogenes serotype 1/2a str. 08-7374 tRNA-Ala
  882. Listeria monocytogenes serotype 1/2a str. 08-7669 tRNA-Ala
  883. Listeria monocytogenes serotype 1/2a str. 10-0812 tRNA-Ala
  884. Listeria monocytogenes serotype 1/2a str. 10-0813 tRNA-Ala
  885. Listeria monocytogenes serotype 1/2a str. 10-0814 tRNA-Ala
  886. Listeria monocytogenes serotype 1/2a str. 10-0815 tRNA-Ala
  887. Listeria monocytogenes serotype 1/2a str. 10-0933 tRNA-Ala
  888. Listeria monocytogenes serotype 1/2a str. 10-0934 tRNA-Ala
  889. Listeria monocytogenes serotype 1/2a str. 10-1046 tRNA-Ala
  890. Listeria monocytogenes serotype 1/2a str. 10-1047 tRNA-Ala
  891. Listeria monocytogenes serotype 1/2a str. 10-1321 tRNA-Ala
  892. Listeria monocytogenes serotype 1/2a str. 10-4754 tRNA-Ala
  893. Listeria monocytogenes serotype 1/2a str. 10-4758 tRNA-Ala
  894. Listeria monocytogenes serotype 1/2a str. 10-5024 tRNA-Ala
  895. Listeria monocytogenes serotype 1/2a str. 88-0478 tRNA-Ala
  896. Listeria monocytogenes serotype 1/2a str. 95-0093 tRNA-Ala
  897. Listeria monocytogenes serotype 1/2a str. 98-2035 tRNA-Ala
  898. Listeria monocytogenes serotype 1/2a str. 99-6370 tRNA-Ala
  899. Listeria monocytogenes serotype 1/2a tRNA-Ala
  900. Listeria monocytogenes serotype 1/2b str. 10-0810 tRNA-Ala
  901. Listeria monocytogenes serotype 1/2b str. 10-0811 tRNA-Ala
  902. Listeria monocytogenes serotype 1/2b tRNA-Ala
  903. Listeria monocytogenes serotype 1/2c str. 10-5025 tRNA-Ala
  904. Listeria monocytogenes serotype 1/2c str. 10-5026 tRNA-Ala
  905. Listeria monocytogenes serotype 1/2c tRNA-Ala
  906. Listeria monocytogenes serotype 3a tRNA-Ala
  907. Listeria monocytogenes serotype 3b tRNA-Ala
  908. Listeria monocytogenes serotype 3c str. 10-5027 tRNA-Ala
  909. Listeria monocytogenes serotype 3c tRNA-Ala
  910. Listeria monocytogenes serotype 4ab tRNA-Ala
  911. Listeria monocytogenes serotype 4a tRNA-Ala
  912. Listeria monocytogenes serotype 4b str. 02-1103 tRNA-Ala
  913. Listeria monocytogenes serotype 4b str. 02-1289 tRNA-Ala
  914. Listeria monocytogenes serotype 4b str. 02-1792 tRNA-Ala
  915. Listeria monocytogenes serotype 4b str. 02-6679 tRNA-Ala
  916. Listeria monocytogenes serotype 4b str. 02-6680 tRNA-Ala
  917. Listeria monocytogenes serotype 4b str. 10-0809 tRNA-Ala
  918. Listeria monocytogenes serotype 4b str. 81-0558 tRNA-Ala
  919. Listeria monocytogenes serotype 4b str. 81-0592 tRNA-Ala
  920. Listeria monocytogenes serotype 4b str. 81-0861 tRNA-Ala
  921. Listeria monocytogenes serotype 4b str. CLIP 80459 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  922. Listeria monocytogenes serotype 4b str. F2365 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  923. Listeria monocytogenes serotype 4b str. H7858 tRNA-Ala
  924. Listeria monocytogenes serotype 4b str. LIS0087 tRNA-Ala
  925. Listeria monocytogenes serotype 4b str. LL195 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  926. Listeria monocytogenes serotype 4b tRNA-Ala
  927. Listeria monocytogenes serotype 4bV str. LS542 tRNA-Ala
  928. Listeria monocytogenes serotype 4bV str. LS642 tRNA-Ala
  929. Listeria monocytogenes serotype 4bV str. LS643 tRNA-Ala
  930. Listeria monocytogenes serotype 4bV str. LS644 tRNA-Ala
  931. Listeria monocytogenes serotype 4bV str. LS645 tRNA-Ala
  932. Listeria monocytogenes serotype 4c tRNA-Ala
  933. Listeria monocytogenes serotype 7 str. SLCC2482 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  934. Listeria monocytogenes SHL005 tRNA-Ala
  935. Listeria monocytogenes SHL006 tRNA-Ala
  936. Listeria monocytogenes SHL007 tRNA-Ala
  937. Listeria monocytogenes SHL008 tRNA-Ala
  938. Listeria monocytogenes SHL009 tRNA-Ala
  939. Listeria monocytogenes SHL010 tRNA-Ala
  940. Listeria monocytogenes SHL011 tRNA-Ala
  941. Listeria monocytogenes SHL012 tRNA-Ala
  942. Listeria monocytogenes SHL013 tRNA-Ala
  943. Listeria monocytogenes SLCC2372 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  944. Listeria monocytogenes SLCC2376 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  945. Listeria monocytogenes SLCC2378 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  946. Listeria monocytogenes SLCC2479 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  947. Listeria monocytogenes SLCC2540 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  948. Listeria monocytogenes SLCC2755 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  949. Listeria monocytogenes SLCC5850 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  950. Listeria monocytogenes SLCC7179 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  951. Listeria monocytogenes str. Scott A tRNA-Ala
  952. Listeria monocytogenes tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  953. Listeria monocytogenes WSLC1001 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  954. Listeria monocytogenes WSLC1042 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  955. Paenilisteria newyorkensis tRNA-Ala(tgc)
  956. Paenilisteria riparia FSL S10-1204 tRNA-Ala
  957. Listeria rocourtiae FSL F6-920 tRNA-Ala
  958. Listeria seeligeri serovar 1/2b str. SLCC3954 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  959. Listeria seeligeri tRNA-Ala(tgc)
  960. Listeria swaminathanii tRNA-Ala
  961. Listeria farberi tRNA-Ala
  962. Listeria farberi tRNA-Ala
  963. Listeria farberi tRNA-Ala
  964. Listeria immobilis tRNA-Ala
  965. Listeria immobilis tRNA-Ala
  966. Listeria sp. FSL L8-0308 tRNA-Ala
  967. Listeria sp. MAN/IMW/UF464 tRNA-Ala
  968. Listeria sp. MAN/IMW/UF545 tRNA-Ala
  969. Listeria sp. MAN/IMW/UF555 tRNA-Ala
  970. Listeria sp. MAN/UKL/UF425 tRNA-Ala
  971. Listeria sp. SHR_NRA_18 tRNA-Ala
  972. Listeria swaminathanii tRNA-Ala
  973. Paenilisteria weihenstephanensis FSL R9-0317 tRNA-Ala
  974. Paenilisteria weihenstephanensis tRNA-Ala
  975. Listeria welshimeri serovar 6b str. SLCC5334 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  976. Listeria welshimeri tRNA-Ala(tgc)
  977. Lysinibacillus sphaericus tRNA-Ala
  978. Mangrovibacillus sp. Mu-81 tRNA-Ala
  979. Margalitia sp. FSL K6-0131 tRNA-Ala
  980. marine sediment metagenome tRNA
  981. Mariniplasma sp. tRNA-Ala
  982. Marinococcus halophilus tRNA-Ala
  983. Marinococcus sp. PL1-022 tRNA-Ala
  984. Mesobacillus foraminis tRNA-Ala
  985. Mesobacillus maritimus tRNA-Ala
  986. Mesobacillus stamsii tRNA-Ala
  987. Mesobacillus zeae tRNA-Ala(tgc)
  988. Metabacillus bambusae tRNA-Ala
  989. Metabacillus endolithicus tRNA-Ala
  990. Metabacillus halosaccharovorans tRNA-Ala
  991. Metabacillus kandeliae tRNA-Ala
  992. Metabacillus litoralis tRNA-Ala
  993. Metabacillus malikii tRNA-Ala
  994. Metabacillus niabensis tRNA-Ala
  995. Metabacillus sp. 22489 tRNA-Ala
  996. Metabacillus sp. B2-18 tRNA-Ala
  997. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Ala
  998. Metabacillus harenarius Metabacillus sp. HB246100 tRNA-Ala
  999. Metabacillus sp. Hm71 tRNA-Ala
  1000. Metabacillus sp. KJ11-3 tRNA-Ala
  1001. Metabacillus elymi tRNA-Ala
  1002. Chryseobacillus diguaensis Metabacillus sp. RGM 3146 tRNA-Ala
  1003. Metabacillus sp. tRNA-Ala
  1004. Metabacillus sp. YM-086 tRNA-Ala
  1005. Methylobacterium frigidaeris tRNA-Ala
  1006. Methylobacterium sp. NPDC097428 tRNA-Ala
  1007. Microbacterium sp. NPDC055442 tRNA-Ala
  1008. Micromonospora aurantiaca (nom. illeg.) tRNA-Ala
  1009. Mycobacterium avium subsp. hominissuis tRNA-Ala
  1010. Mycobacteroides abscessus subsp. abscessus tRNA-Ala(tgc)
  1011. Mycobacteroides abscessus subsp. massiliense tRNA-Ala(tgc)
  1012. Natronobacillus azotifigens tRNA-Ala
  1013. Neobacillus canaveralius tRNA-Ala
  1014. Neobacillus citreus tRNA-Ala
  1015. Neobacillus drentensis tRNA-Ala
  1016. Neobacillus driksii tRNA-Ala
  1017. Neobacillus endophyticus tRNA-Ala
  1018. Neobacillus ginsengisoli tRNA-Ala
  1019. Neobacillus mesonae tRNA-Ala
  1020. Neobacillus niacini tRNA-Ala
  1021. Neobacillus novalis tRNA-Ala
  1022. Neobacillus paridis tRNA-Ala
  1023. Neobacillus phoenicis tRNA-Ala
  1024. Neobacillus pocheonensis tRNA-Ala
  1025. Neobacillus rhizophilus tRNA-Ala
  1026. Neobacillus sedimentimangrovi tRNA-Ala
  1027. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Ala
  1028. Neobacillus sp. 19 tRNA-Ala
  1029. Neobacillus sp. 204 tRNA-Ala
  1030. Neobacillus sp. 211 tRNA-Ala
  1031. Neobacillus sp. B24 tRNA-Ala
  1032. Neobacillus sp. B4I6 tRNA-Ala
  1033. Neobacillus sp. BF23-41 tRNA-Ala
  1034. Neobacillus sp. CF12 tRNA-Ala
  1035. Neobacillus sp. DFD-2R tRNA-Ala
  1036. Neobacillus sp. DHD-1R tRNA-Ala
  1037. Neobacillus sp. DY30 tRNA-Ala
  1038. Neobacillus sp. GCM10023253 tRNA-Ala
  1039. Neobacillus rhizosphaerae tRNA-Ala
  1040. Neobacillus sp. K501 tRNA-Ala
  1041. Neobacillus solisequens Neobacillus sp. LXY-1 tRNA-Ala
  1042. Neobacillus terrisolis Neobacillus sp. LXY-4 tRNA-Ala
  1043. Neobacillus sp. MM2021_6 tRNA-Ala
  1044. Neobacillus sp. NPDC058068 tRNA-Ala
  1045. Neobacillus sp. NPDC093182 tRNA-Ala
  1046. Neobacillus sp. NRS-1170 tRNA-Ala
  1047. Neobacillus sp. OS1-2 tRNA-Ala
  1048. Neobacillus sp. OS1-32 tRNA-Ala
  1049. Neobacillus nitrireducens tRNA-Ala
  1050. Neobacillus sp. PS2-9 tRNA-Ala
  1051. Neobacillus sp. PS3-34 tRNA-Ala
  1052. Neobacillus sp. PVCKKU3 tRNA-Ala
  1053. Neobacillus sp. S1115 tRNA-Ala
  1054. Neobacillus sp. S1227 tRNA-Ala
  1055. Neobacillus sp. SAB-20_R2A tRNA-Ala
  1056. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Ala
  1057. Neobacillus sp. tRNA-Ala
  1058. Neobacillus sp. WH10 tRNA-Ala
  1059. Neobacillus sp. YX16 tRNA-Ala
  1060. Neobacillus thermocopriae tRNA-Ala
  1061. Neobacillus vireti tRNA-Ala
  1062. Niallia oryzisoli tRNA-Ala
  1063. Niallia sp. XMNu-256 tRNA-Ala
  1064. Nocardia ignorata tRNA-Ala
  1065. Nocardia panacis tRNA-Ala
  1066. Nocardia tengchongensis tRNA-Ala
  1067. Nocardioides sp. YIM B13467 tRNA-Ala
  1068. Oceanobacillus bengalensis tRNA-Ala
  1069. Oceanobacillus caeni tRNA-Ala
  1070. Oceanobacillus halophilus tRNA-Ala
  1071. Oceanobacillus sp. FSL K6-0118 tRNA-Ala
  1072. Odoribacter splanchnicus tRNA-Ala
  1073. Oikeobacillus pervagus tRNA-Ala
  1074. Oribacterium sinus tRNA-Ala
  1075. Paenarthrobacter sp. NPDC056912 tRNA-Ala
  1076. Paenibacillus sp. BSR1-1 tRNA-Ala
  1077. Paenibacillus sp. FSL R5-0490 tRNA-Ala
  1078. Paenibacillus sp. ICGEB2008 tRNA-Ala
  1079. Paenilisteria portnoyi tRNA-Ala
  1080. Paenilisteria rocourtiae tRNA-Ala
  1081. Paenilisteria rustica tRNA-Ala
  1082. Pallidibacillus pasinlerensis tRNA-Ala
  1083. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Ala
  1084. Pallidibacillus thermolactis tRNA-Ala
  1085. Paraburkholderia sp. SIMBA_016 tRNA-Ala
  1086. Paraburkholderia sp. SIMBA_058 tRNA-Ala
  1087. Paraliobacillus quinghaiensis tRNA-Ala
  1088. Paraliobacillus ryukyuensis tRNA-Ala
  1089. Paraliobacillus sp. JSM ZJ581 tRNA-Ala
  1090. Paraliobacillus sp. PM-2 tRNA-Ala
  1091. Perspicuibacillus lycopersici tRNA-Ala
  1092. Piscibacillus salipiscarius tRNA-Ala
  1093. Piscibacillus sp. B03 tRNA-Ala
  1094. Pontibacillus chungwhensis tRNA-Ala
  1095. Pontibacillus salipaludis tRNA-Ala
  1096. Pontibacillus sp. ABV4_188 tRNA-Ala
  1097. Pontibacillus sp. HN14 tRNA-Ala
  1098. Pradoshia sp. D12 tRNA-Ala
  1099. Proteus vulgaris tRNA-Ala
  1100. Pseudobacillus badius tRNA-Ala
  1101. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Ala
  1102. Pseudobacillus sp. FSL P4-0506 tRNA-Ala
  1103. Pseudomonadota bacterium tRNA-Ala
  1104. Pseudomonas cedrina subsp. cedrina tRNA-Ala
  1105. Bacillus subtilis A29 tRNA-Ala
  1106. Pseudomonas sp. EGD-AK9 tRNA-Ala
  1107. Pseudomonas sp. ISL-84 tRNA-Ala
  1108. Psychrobacillus sp. MER TA 17 tRNA-Ala
  1109. Pullulanibacillus sp. KACC 23026 tRNA-Ala
  1110. Radiobacillus kanasensis tRNA-Ala
  1111. Rathayibacter tritici tRNA-Ala
  1112. Rhizobium sp. SIMBA_035 tRNA-Ala
  1113. Rhodococcus koreensis tRNA-Ala
  1114. Rhodococcus qingshengii tRNA-Ala
  1115. Rhodothalassium salexigens DSM 2132 tRNA-Ala
  1116. Anoxybacillus andreesenii tRNA-Ala
  1117. Robertmurraya crescens tRNA-Ala
  1118. Rossellomorea aquimaris tRNA-Ala
  1119. Rossellomorea arthrocnemi tRNA-Ala
  1120. Rossellomorea orangium tRNA-Ala
  1121. Rossellomorea oryzaecorticis tRNA-Ala
  1122. Rossellomorea pakistanensis tRNA-Ala
  1123. Rossellomorea sedimentorum tRNA-Ala
  1124. Rossellomorea sp. ABR4_004 tRNA-Ala
  1125. Rossellomorea sp. ABR4_012 tRNA-Ala
  1126. Rossellomorea sp. AcN35-11 tRNA-Ala
  1127. Rossellomorea sp. BNER tRNA-Ala
  1128. Rossellomorea sp. DA94 tRNA-Ala
  1129. Rossellomorea sp. DUT-2 tRNA-Ala
  1130. Rossellomorea sp. FS2 tRNA-Ala
  1131. Rossellomorea sp. GCM10028870 tRNA-Ala
  1132. Rossellomorea sp. H39__3 tRNA-Ala
  1133. Rossellomorea sp. KS-H15a tRNA-Ala
  1134. Rossellomorea sp. LJF3 tRNA-Ala
  1135. Rossellomorea sp. LjRoot5 tRNA-Ala
  1136. Rossellomorea sp. NPDC071047 tRNA-Ala
  1137. Rossellomorea sp. NPDC077527 tRNA-Ala
  1138. Rossellomorea sp. NRS-1567 tRNA-Ala
  1139. Rossellomorea sp. NS-SX7 tRNA-Ala
  1140. Rossellomorea sp. QJM3NY_18 tRNA-Ala
  1141. Rossellomorea sp. SC111 tRNA-Ala
  1142. Rossellomorea sp. y25 tRNA-Ala
  1143. Rossellomorea sp. YZS02 tRNA-Ala
  1144. Rossellomorea yichunensis tRNA-Ala
  1145. Rummeliibacillus suwonensis tRNA-Ala
  1146. Salimicrobium halophilum tRNA_Ala_TGC
  1147. Salimicrobium jeotgali tRNA-Ala
  1148. Salimicrobium sp. PL1-032A tRNA-Ala
  1149. Salimicrobium humidisoli tRNA-Ala
  1150. Salinibacillus aidingensis tRNA-Ala
  1151. Salipaludibacillus agaradhaerens tRNA-Ala
  1152. Salipaludibacillus sp. CUR1 tRNA-Ala
  1153. Salipaludibacillus keqinensis tRNA-Ala
  1154. Salipaludibacillus sp. LMS25 tRNA-Ala
  1155. Salisediminibacterium halotolerans tRNA-Ala
  1156. Salmonella enterica subsp. enterica serovar Agona tRNA-Ala
  1157. Salmonella enterica tRNA-Ala
  1158. Salmonella sp. NW1015 tRNA-Ala
  1159. Scopulibacillus cellulosilyticus tRNA-Ala
  1160. Scopulibacillus daqui tRNA-Ala
  1161. Sediminibacillus dalangtanensis tRNA-Ala
  1162. Shouchella clausii KSM-K16 tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  1163. Shouchella clausii tRNA-Ala
  1164. Shouchella hunanensis tRNA-Ala
  1165. Shouchella lehensis G1 tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  1166. Shouchella miscanthi tRNA-Ala
  1167. Shouchella phoenicis tRNA-Ala
  1168. Shouchella rhizosphaerae tRNA-Ala
  1169. Shouchella phoenicis Shouchella sp. 1P09AA tRNA-Ala
  1170. Shouchella sp. JSM 1781072 tRNA-Ala
  1171. Siminovitchia fordii tRNA-Ala
  1172. Siminovitchia fortis tRNA-Ala
  1173. Siminovitchia sediminis tRNA-Ala
  1174. Siminovitchia jepli Siminovitchia sp. 179-K 8D1 HS tRNA-Ala
  1175. Siminovitchia sp. FSL H7-0308 tRNA-Ala
  1176. Siminovitchia sp. FSL W7-1587 tRNA-Ala
  1177. Siminovitchia terrae tRNA-Ala
  1178. Siminovitchia thermophila tRNA-Ala
  1179. soil metagenome tRNA
  1180. Solibacillus sp. FSL R7-0682 tRNA-Ala
  1181. Bacillus velezensis A3 tRNA-Ala
  1182. Sporolactobacillaceae bacterium tRNA-Ala
  1183. Sporolactobacillus shoreicorticis tRNA-Ala
  1184. Sporolactobacillus sp. PKMT-3 tRNA-Ala
  1185. Sporolactobacillus sp. PKPK-6 tRNA-Ala
  1186. Sporolactobacillus sp. STSJ-5 tRNA-Ala
  1187. Sporolactobacillus terrae tRNA-Ala
  1188. Sporosarcina globispora tRNA-Ala
  1189. Staphylococcus aureus tRNA-Ala
  1190. Staphylococcus epidermidis tRNA-Ala
  1191. Staphylococcus sp. B1(2026) tRNA-Ala
  1192. Stenotrophomonas bentonitica tRNA-Ala
  1193. Streptococcus pneumoniae tRNA-Ala(tgc)
  1194. Streptococcus pyogenes tRNA-Ala
  1195. Streptococcus salivarius tRNA-Ala
  1196. Streptococcus sp. UMB1385 tRNA-Ala
  1197. Streptomyces albidoflavus tRNA-Ala
  1198. Streptomyces anulatus tRNA-Ala
  1199. Streptomyces bikiniensis tRNA-Ala
  1200. Streptomyces cinereoruber tRNA-Ala
  1201. Streptomyces cyaneofuscatus tRNA-Ala
  1202. Streptomyces diastaticus tRNA-Ala
  1203. Streptomyces erythrochromogenes tRNA-Ala
  1204. Streptomyces griseus Streptomyces fimicarius tRNA-Ala
  1205. Streptomyces fungicidicus tRNA-Ala
  1206. Streptomyces globisporus tRNA-Ala
  1207. Streptomyces griseoaurantiacus tRNA-Ala
  1208. Streptomyces griseoincarnatus tRNA-Ala
  1209. Streptomyces griseus tRNA-Ala(tgc)
  1210. Streptomyces hydrogenans tRNA-Ala
  1211. Streptomyces mirabilis tRNA-Ala
  1212. Streptomyces mutabilis tRNA-Ala
  1213. Streptomyces niveus tRNA-Ala
  1214. Streptomyces olivaceus tRNA-Ala
  1215. Streptomyces rochei tRNA-Ala
  1216. Streptomyces roseolus tRNA-Ala
  1217. Streptomyces rubiginosohelvolus tRNA-Ala
  1218. Streptomyces sp. D2-8 tRNA-Ala
  1219. Streptomyces sp. NPDC053429 tRNA-Ala
  1220. Streptomyces sp. NPDC055055 tRNA-Ala
  1221. Streptomyces sp. NPDC055299 tRNA-Ala
  1222. Streptomyces sp. NPDC055335 tRNA-Ala
  1223. Streptomyces sp. NPDC056084 tRNA-Ala
  1224. Streptomyces sp. NPDC056086 tRNA-Ala
  1225. Streptomyces sp. NPDC056105 tRNA-Ala
  1226. Streptomyces sp. NPDC056127 tRNA-Ala
  1227. Streptomyces sp. NPDC056161 tRNA-Ala
  1228. Streptomyces sp. NPDC056308 tRNA-Ala
  1229. Streptomyces sp. NPDC056401 tRNA-Ala
  1230. Streptomyces sp. NPDC056580 tRNA-Ala
  1231. Streptomyces sp. NPDC056639 tRNA-Ala
  1232. Streptomyces sp. NPDC056647 tRNA-Ala
  1233. Streptomyces sp. NPDC056664 tRNA-Ala
  1234. Streptomyces sp. NPDC056734 tRNA-Ala
  1235. Streptomyces sp. NPDC056910 tRNA-Ala
  1236. Streptomyces sp. NPDC056944 tRNA-Ala
  1237. Streptomyces sp. NPDC057002 tRNA-Ala
  1238. Streptomyces sp. NPDC057092 tRNA-Ala
  1239. Streptomyces sp. NPDC057136 tRNA-Ala
  1240. Streptomyces sp. NPDC057239 tRNA-Ala
  1241. Streptomyces sp. NPDC057286 tRNA-Ala
  1242. Streptomyces sp. NPDC057287 tRNA-Ala
  1243. Streptomyces sp. NPDC057293 tRNA-Ala
  1244. Streptomyces sp. NPDC057298 tRNA-Ala
  1245. Streptomyces sp. NPDC057438 tRNA-Ala
  1246. Streptomyces sp. NPDC057555 tRNA-Ala
  1247. Streptomyces sp. NPDC057579 tRNA-Ala
  1248. Streptomyces sp. NPDC057596 tRNA-Ala
  1249. Streptomyces sp. NPDC057636 tRNA-Ala
  1250. Streptomyces sp. NPDC057651 tRNA-Ala
  1251. Streptomyces sp. NPDC057689 tRNA-Ala
  1252. Streptomyces sp. NPDC057697 tRNA-Ala
  1253. Streptomyces sp. NPDC057740 tRNA-Ala
  1254. Streptomyces sp. NPDC057743 tRNA-Ala
  1255. Streptomyces sp. NPDC057746 tRNA-Ala
  1256. Streptomyces sp. NPDC058052 tRNA-Ala
  1257. Streptomyces sp. NPDC058142 tRNA-Ala
  1258. Streptomyces sp. NPDC058279 tRNA-Ala
  1259. Streptomyces sp. NPDC059452 tRNA-Ala
  1260. Streptomyces sp. NPDC059919 tRNA-Ala
  1261. Streptomyces sp. NPDC060232 tRNA-Ala
  1262. Streptomyces sp. NPDC126933 tRNA-Ala
  1263. Streptomyces sp. NPDC127132 tRNA-Ala
  1264. Streptomyces sp. NPDC127172 tRNA-Ala
  1265. Streptomyces tendae tRNA-Ala
  1266. Streptomyces venezuelae tRNA-Ala
  1267. Streptomyces zhihengii tRNA-Ala
  1268. Sutcliffiella halmapala tRNA-Ala
  1269. Sutcliffiella horikoshii tRNA-Ala
  1270. Sutcliffiella sp. FSL R7-0096 tRNA-Ala
  1271. Sutcliffiella sp. NPDC057660 tRNA-Ala
  1272. Sutcliffiella tianshenii tRNA-Ala
  1273. Tenuibacillus multivorans tRNA-Ala
  1274. Terribacillus aidingensis tRNA-Ala
  1275. Terribacillus saccharophilus tRNA-Ala
  1276. Terribacillus sp. FSL K6-0262 tRNA-Ala
  1277. Terrihalobacillus insolitus tRNA-Ala
  1278. Terrilactibacillus laevilacticus tRNA-Ala
  1279. Terrilactibacillus tamarindi tRNA-Ala
  1280. Thalassobacillus devorans tRNA-Ala
  1281. Thalassobacillus hwangdonensis tRNA-Ala
  1282. Thalassobacillus pellis tRNA-Ala
  1283. Thalassobacillus sp. B23F22_16 tRNA-Ala
  1284. Thalassobacillus sp. FIB228 tRNA-Ala
  1285. Tigheibacillus halophilus tRNA-Ala
  1286. Tigheibacillus jepli tRNA-Ala
  1287. Tistrella mobilis tRNA-Ala
  1288. uncultured Bacillus sp. tRNA
  1289. uncultured Cytobacillus sp. tRNA
  1290. uncultured Halobacillus sp. tRNA
  1291. uncultured Melghiribacillus sp. tRNA
  1292. uncultured Pseudonocardia sp. tRNA
  1293. uncultured Rossellomorea sp. tRNA
  1294. uncultured Ureibacillus sp. tRNA
  1295. Ureibacillus sp. tRNA-Ala
  1296. Variovorax sp. CCNWLW225 tRNA-Ala
  1297. Veillonella sp. tRNA-Ala
  1298. Virgibacillus dakarensis tRNA-Ala
  1299. Virgibacillus sediminis tRNA
  1300. Paracerasibacillus soli tRNA-Ala
  1301. Virgibacillus sp. MSP4-1 tRNA-Ala
  1302. Weizmannia acidilactici tRNA-Ala
  1303. Weizmannia sp. CD-2023 tRNA-Ala
  1304. Weizmannia sp. FSL K6-0777 tRNA-Ala
  1305. Weizmannia sp. FSL K6-3076 tRNA-Ala
  1306. Weizmannia sp. FSL W8-0401 tRNA-Ala
  1307. Weizmannia sp. FSL W8-0676 tRNA-Ala
  1308. Weizmannia sp. FSL W8-1119 tRNA-Ala
  1309. Weizmannia sp. WK01 tRNA-Ala
  1310. Xanthomonas citri pv. citri tRNA-Ala
Relationships

Molecular Relationships

2D structure

Loading 2D structure...