Macaca mulatta (Rhesus monkey) microRNA mml-mir-151 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) microRNA mml-mir-151 precursor URS00002ECE14_9544

90 nucleotides
3 databases (ENA, miRBase, RefSeq)
Found in 12 other species
13 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUCCUUGAGGACAGGGAUGGUCAUACUCACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Cercocebus atys miRNA (ENSCATG00000019658.1)
Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000003940.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 151a (ENSGGOG00000032270.2)
Homo sapiens microRNA hsa-mir-151a precursor
Macaca nemestrina miRNA (ENSMNEG00000024451.1)
Mandrillus leucophaeus miRNA (ENSMLEG00000009299.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 151a (ENSNLEG00000025049.2)
Pan paniscus (bonobo) microRNA 151a (ENSPPAG00000014380.1)
Pan troglodytes (chimpanzee) ptr-mir-151 (ENSPTRG00000027696.2)
Rhinopithecus bieti miRNA (ENSRBIG00000019763.1)
Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000013154.1)

Publications