Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 151a (ENSNLEG00000025049.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 151a (ENSNLEG00000025049.2) URS00002ECE14_61853

90 nucleotides
1 database (Ensembl)
Found in 13 other species
8 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUCCUUGAGGACAGGGAUGGUCAUACUCACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Cercocebus atys miRNA (ENSCATG00000019658.1)
Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000003940.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 151a (ENSGGOG00000032270.2)
Homo sapiens microRNA hsa-mir-151a precursor
Macaca mulatta (Rhesus monkey) microRNA mml-mir-151 precursor
Macaca nemestrina miRNA (ENSMNEG00000024451.1)
Mandrillus leucophaeus miRNA (ENSMLEG00000009299.1)
Pan paniscus (bonobo) microRNA 151a (ENSPPAG00000014380.1)
Pan troglodytes (chimpanzee) ptr-mir-151 (ENSPTRG00000027696.2)
Rhinopithecus bieti miRNA (ENSRBIG00000019763.1)
Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000013154.1)

Publications