Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-876-3p URS00002E8D60_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-876: Hsa-mir-876 is a microRNA that has been studied in relation to endometrial cancer (EC) [PMC9318842]. In a study comparing EC tissues and adjacent non-tumor tissues, there was no significant difference in the expression of hsa-mir-876 between the two [PMC9318842]. However, hsa-mir-876 has been identified as one of the indicators that can be used to predict the survival rate of EC patients [PMC9318842]. Additionally, hsa-mir-876 was found to be downregulated with a deletion in DNA codifying for the pri- or pre-miRNA in a combination of deregulated miRNA and their copy number alterations (CNAs) [PMC5877771]. Furthermore, an integrated bioinformatics approach identified hsa-mir-876 as one of the nine m7G-related miRNAs associated with the survival of uterine corpus endometrial carcinoma (UCEC) patients [PMC9713471]. In UCEC patients, high expression levels of hsa-mir-876 were associated with significantly lower survival rates compared to those with low expression levels [PMC9713471]. In summary, hsa-mir-876 is a microRNA that has been studied in relation to EC and UCEC. While its expression levels did not significantly differ between EC tissues and adjacent non-tumor tissues, it can be used as an indicator for predicting the survival rate of EC patients. Additionally, alterations in DNA codifying for hsa-mir-876 have been observed. In UCEC patients, high expression levels of hsa-mir-876 were associated with lower survival rates.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGGUUUACAAAGUAAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Publications