v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-451 URS00002E857A_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-451: Ssc-mir-451, ssc-miR-486, and ssc-miR-1285 were identified as differential genes in a study that used qPCR assays on tissue samples at 0 and 12 hours after perfusion [PMC9275911]. The study compared the fatty acid composition between pigs with low and high expression levels of ssc-mir-451, with the high expression group having twice the expression level compared to the low expression group [PMC7602835].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACCGUUACCAUUACUGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis Ami-Mir-451_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-451-5p
  3. Bos taurus (cattle) Bta-Mir-451_5p (mature (guide))
  4. Canis lupus familiaris (dog) cfa-miR-451
  5. Cavia porcellus (domestic guinea pig) Cpo-Mir-451_5p (mature (guide))
  6. Cricetulus griseus cgr-miR-451a
  7. Danio rerio (zebrafish) dre-miR-451
  8. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-451_5p (mature (guide))
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-451_5p (mature (guide))
  10. Gadus morhua (Atlantic cod) Gmo-Mir-451_5p (mature (guide))
  11. Gallus gallus (chicken) Gga-Mir-451_5p (mature (guide))
  12. Homo sapiens (human) hsa-miR-451a
  13. Macaca mulatta (Rhesus monkey) mml-miR-451
  14. Mus musculus (house mouse) mmu-miR-451a
  15. Ornithorhynchus anatinus (platypus) Oan-Mir-451_5p (mature (guide))
  16. Oryctolagus cuniculus (rabbit) Ocu-Mir-451_5p (mature (guide))
  17. Pan troglodytes ptr-miR-451
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-451
  19. Rattus norvegicus (Norway rat) rno-miR-451-5p
  20. Taeniopygia guttata Tgu-Mir-451_5p (mature (guide))
  21. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-451_5p (mature (guide))
  22. Tor tambroides (Thai mahseer) miR-451
  23. Tursiops truncatus (common bottlenose dolphin) miR-451a
  24. Xenopus laevis (African clawed frog) Xla-Mir-451-P2_5p (mature (guide))
  25. Xenopus tropicalis xtr-miR-451
 Publications