Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-451-5p URS00002E857A_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-451: Rno-mir-451 is a microRNA that is expressed in blood cells in vivo [PMC4184830]. The expression patterns of GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-mir-451 were measured using real-time RT-PCR in the context of LHR downregulation [PMC4184830]. Rno-miR-144 and rno-miR-376a expression peaked 12 hours after hCG treatment, while rno-mir-451 expression peaked 24 hours after hCG treatment [PMC4184830]. Rno-miR-144 and rno-mir-451 were not induced by hCG treatment [PMC4184830]. Bioinformatics analysis revealed that rno-miR-144, rno-miR-376a, and rno-mir-451 can bind to the 3'-UTR of GRP78 mRNA and negatively regulate its expression [PMC4184830]. However, their expression decreased significantly after hCG treatment [PMC4184830]. The array data and bioinformatics analysis led to a focus on these microRNAs in relation to GRP78 mRNA regulation [PMC4184830]. The effects of these microRNAs on GRP78 mRNA expression were investigated in granulosa cells isolated from DES-treated immature rats [PMC4184830]. Rno-mir-451 was found to be 10-fold more abundant at E10 than at any other stages, suggesting its potential role in the regulation of progenitor cell proliferation [PMC3441217].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACCGUUACCAUUACUGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

Publications