Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR393b-3p URS00002E805E_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR393b-3p: Ath-mir393b-3p is a defense-related miRNA that has been experimentally confirmed to be functionally associated with AGO2 [PMC7201365]. AGO2 binds ath-mir393b-3p, along with ath-miR391-3p and ath-miR472-5p, to repress the expression of GST and RbohF genes [PMC7201365]. These differentially expressed genes (DEGs) are regulated by ath-miR391-3p, ath-mir393b-3p, and ath-miR472-5p [PMC7201365]. Ath-mir393b-3p is also known as ath-miR393b∗ [PMC7201365]. Among the most abundant AGO2-bound small RNAs (sRNAs) are ath-miR391-3p, ath-mir393b-3p, and ath-miR472-5p [PMC7201365]. Ath-mir393b-3p is one of the six sRNAs that had reads of over 100 [PMC7201365]. Additionally, five sRNAs including ath-miR398b-3p/ath miR398c 3P, 1_41269_5P, and 1_41269_4P also had reads higher than 100 [PMC7201365].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUGCGAUCUCUUUGGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications