Homo sapiens (human) Hsa-Mir-448_5p (mature (co-guide))

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-448_5p (mature (co-guide)) URS00002DE3D0_9606

22 nucleotides
2 databases (GeneCards, MirGeneDB)
Found in 2 other species
18 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-448: Hsa-mir-448 is a microRNA that can competitively bind with miR-1, leading to an impact on the expression of CDC42 [PMC8656502]. In a study, KDM2B 3′-UTR, mutated KDM2B 3′-UTR, or control luciferase reporter plasmid were co-transfected with either mirVana™ miR mimic hsa-mir-448 or mirVanaTM miR mimic negative control [PMC5008346]. The transfection was carried out using FugeneHD:DNA ratio of 3:1 or Lipofectamine 3000 [PMC5008346].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GAACAUCCUGCAUAGUGCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Mus musculus mmu-miR-448-5p
Oryctolagus cuniculus ocu-miR-448-5p

Publications