Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Loxodonta africana tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1) secondary structure diagram

Loxodonta africana tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1) URS00002D4542_9785

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCGCGGGUUCGAACCCCGUCCGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 109 other species

  1. Ailuropoda melanoleuca tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  2. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  3. Albula goreensis tRNA-Thr
  4. Alligator mississippiensis tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  5. Alosa alosa tRNA-Thr
  6. Ameiurus melas (black bullhead) tRNA-Thr
  7. Anguilla anguilla (European eel) tRNA-Thr
  8. Anolis carolinensis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  9. Astyanax mexicanus tRNA
  10. Ataeniobius toweri tRNA-Thr
  11. Balaenoptera acutorostrata scammoni tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  12. Bos taurus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  13. Callipepla squamata tRNA
  14. Callithrix jacchus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  15. Calypte anna tRNA
  16. Camelus ferus tRNA
  17. Carlito syrichta tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  18. Cavia porcellus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  19. Characodon lateralis tRNA-Thr
  20. Chelonia mydas (green seaturtle) tRNA
  21. Chelydra serpentina (Common snapping turtle) tRNA-Thr
  22. Chlorocebus sabaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  23. Choloepus hoffmanni tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  24. Chrysemys picta bellii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  25. Colinus virginianus tRNA
  26. Columba livia (Rock pigeon) tRNA
  27. Crenichthys baileyi tRNA-Thr
  28. Cricetulus griseus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  29. Dallia pectoralis tRNA-OTHER
  30. Danionella translucida tRNA-Thr
  31. Danio rerio tRNA
  32. Dasypus novemcinctus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  33. Dipodomys ordii tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  34. Echinops telfairi tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  35. Eptesicus nilssonii tRNA-Thr
  36. Erinaceus europaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  37. Felis catus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  38. Fukomys damarensis (Damara mole-rat) tRNA
  39. Gadus morhua tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  40. Gallus gallus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  41. Gasterosteus aculeatus (three-spined stickleback) tRNA
  42. Gorilla gorilla gorilla tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  43. Heterocephalus glaber tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  44. Hippoglossus stenolepis tRNA-Thr
  45. Homo sapiens tRNA-Thr (anticodon CGT) 4-1 (TRT-CGT4-1)
  46. Ictidomys tridecemlineatus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  47. Lamprotornis superbus tRNA-OTHER
  48. Larimichthys crocea tRNA
  49. Latimeria chalumnae tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  50. Lepisosteus oculatus tRNA
  51. Lonchura striata domestica tRNA
  52. Macaca mulatta tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  53. Manacus vitellinus (golden-collared manakin) tRNA
  54. Marmota monax tRNA.Thr
  55. Megalops atlanticus tRNA-Thr
  56. Merluccius polli tRNA-Thr
  57. Mesitornis unicolor tRNA
  58. Mesocricetus auratus tRNA
  59. Microcebus murinus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  60. Monodelphis domestica tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  61. Mus caroli tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  62. Mus musculus castaneus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  63. Mus musculus domesticus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  64. Mus musculus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  65. Mus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-4-1)
  66. Mus pahari tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  67. Mus spretus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  68. Mustela putorius furo tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  69. Myotis brandtii tRNA
  70. Myotis davidii tRNA
  71. Myotis lucifugus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  72. Nomascus leucogenys tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  73. Notamacropus eugenii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  74. Nothobranchius furzeri tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  75. Ochotona princeps tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  76. Oreochromis niloticus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  77. Ornithorhynchus anatinus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2)
  78. Oryctolagus cuniculus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  79. Oryzias latipes tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  80. Otolemur garnettii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  81. Ovis aries tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  82. Pangasianodon gigas (Mekong giant catfish) tRNA-Thr
  83. Pangasianodon hypophthalmus tRNA-Thr
  84. Pangasius djambal tRNA-Thr
  85. Pan troglodytes tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  86. Papio anubis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  87. Patagioenas fasciata monilis tRNA
  88. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  89. Perca flavescens tRNA-Thr
  90. Perca fluviatilis (European perch) tRNA-Thr
  91. Petromyzon marinus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  92. Pleuronectes platessa tRNA-Thr
  93. Podarcis lilfordi tRNA.Thr
  94. Poecilia formosa tRNA
  95. Pongo abelii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  96. Pteropus alecto tRNA
  97. Rattus norvegicus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  98. Saimiri boliviensis boliviensis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  99. Salmo salar (Atlantic salmon) tRNA
  100. Scleropages formosus (Asian bonytongue) tRNA
  101. Sorex araneus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  102. Sphaerodactylus townsendi tRNA-Thr
  103. Sus scrofa tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1)
  104. Taeniopygia guttata tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  105. Takifugu rubripes tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  106. Tetraodon nigroviridis tRNA
  107. Trichechus manatus latirostris tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  108. Tupaia chinensis tRNA
  109. Xiphophorus maculatus tRNA
2D structure Publications