Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anolis carolinensis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1) secondary structure diagram

Anolis carolinensis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1) URS00002D4542_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCGCGGGUUCGAACCCCGUCCGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 109 other species

  1. Ailuropoda melanoleuca tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  2. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  3. Albula goreensis tRNA-Thr
  4. Alligator mississippiensis tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  5. Alosa alosa tRNA-Thr
  6. Ameiurus melas (black bullhead) tRNA-Thr
  7. Anguilla anguilla (European eel) tRNA-Thr
  8. Astyanax mexicanus tRNA
  9. Ataeniobius toweri tRNA-Thr
  10. Balaenoptera acutorostrata scammoni tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  11. Bos taurus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  12. Callipepla squamata tRNA
  13. Callithrix jacchus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  14. Calypte anna tRNA
  15. Camelus ferus tRNA
  16. Carlito syrichta tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  17. Cavia porcellus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  18. Characodon lateralis tRNA-Thr
  19. Chelonia mydas (green seaturtle) tRNA
  20. Chelydra serpentina (Common snapping turtle) tRNA-Thr
  21. Chlorocebus sabaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  22. Choloepus hoffmanni tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  23. Chrysemys picta bellii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  24. Colinus virginianus tRNA
  25. Columba livia (Rock pigeon) tRNA
  26. Crenichthys baileyi tRNA-Thr
  27. Cricetulus griseus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  28. Dallia pectoralis tRNA-OTHER
  29. Danionella translucida tRNA-Thr
  30. Danio rerio tRNA
  31. Dasypus novemcinctus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  32. Dipodomys ordii tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  33. Echinops telfairi tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  34. Eptesicus nilssonii tRNA-Thr
  35. Erinaceus europaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  36. Felis catus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  37. Fukomys damarensis (Damara mole-rat) tRNA
  38. Gadus morhua tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  39. Gallus gallus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  40. Gasterosteus aculeatus (three-spined stickleback) tRNA
  41. Gorilla gorilla gorilla tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  42. Heterocephalus glaber tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  43. Hippoglossus stenolepis tRNA-Thr
  44. Homo sapiens tRNA-Thr (anticodon CGT) 4-1 (TRT-CGT4-1)
  45. Ictidomys tridecemlineatus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  46. Lamprotornis superbus tRNA-OTHER
  47. Larimichthys crocea tRNA
  48. Latimeria chalumnae tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  49. Lepisosteus oculatus tRNA
  50. Lonchura striata domestica tRNA
  51. Loxodonta africana tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1)
  52. Macaca mulatta tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  53. Manacus vitellinus (golden-collared manakin) tRNA
  54. Marmota monax tRNA.Thr
  55. Megalops atlanticus tRNA-Thr
  56. Merluccius polli tRNA-Thr
  57. Mesitornis unicolor tRNA
  58. Mesocricetus auratus tRNA
  59. Microcebus murinus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  60. Monodelphis domestica tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  61. Mus caroli tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  62. Mus musculus castaneus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  63. Mus musculus domesticus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  64. Mus musculus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  65. Mus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-4-1)
  66. Mus pahari tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  67. Mus spretus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  68. Mustela putorius furo tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  69. Myotis brandtii tRNA
  70. Myotis davidii tRNA
  71. Myotis lucifugus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  72. Nomascus leucogenys tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  73. Notamacropus eugenii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  74. Nothobranchius furzeri tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  75. Ochotona princeps tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  76. Oreochromis niloticus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  77. Ornithorhynchus anatinus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2)
  78. Oryctolagus cuniculus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  79. Oryzias latipes tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  80. Otolemur garnettii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  81. Ovis aries tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  82. Pangasianodon gigas (Mekong giant catfish) tRNA-Thr
  83. Pangasianodon hypophthalmus tRNA-Thr
  84. Pangasius djambal tRNA-Thr
  85. Pan troglodytes tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  86. Papio anubis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  87. Patagioenas fasciata monilis tRNA
  88. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  89. Perca flavescens tRNA-Thr
  90. Perca fluviatilis (European perch) tRNA-Thr
  91. Petromyzon marinus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  92. Pleuronectes platessa tRNA-Thr
  93. Podarcis lilfordi tRNA.Thr
  94. Poecilia formosa tRNA
  95. Pongo abelii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  96. Pteropus alecto tRNA
  97. Rattus norvegicus tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  98. Saimiri boliviensis boliviensis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  99. Salmo salar (Atlantic salmon) tRNA
  100. Scleropages formosus (Asian bonytongue) tRNA
  101. Sorex araneus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  102. Sphaerodactylus townsendi tRNA-Thr
  103. Sus scrofa tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1)
  104. Taeniopygia guttata tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  105. Takifugu rubripes tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-1-2)
  106. Tetraodon nigroviridis tRNA
  107. Trichechus manatus latirostris tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  108. Tupaia chinensis tRNA
  109. Xiphophorus maculatus tRNA
2D structure Publications