v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus subtilis subsp. subtilis str. 168 SAM riboswitch (S box leader) secondary structure diagram

Bacillus subtilis subsp. subtilis str. 168 SAM riboswitch (S box leader) URS00002D29F6_224308

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAAGCUUCAGCAACCGGUGUAAUGGCGAUCAGCCAUGACCAAGGUGCUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Bacillus subtilis SAM riboswitch (S box leader)
  2. Pseudomonas sp. EGD-AK9 SAM riboswitch (S box leader)
  3. Pseudomonas sp. SAM-I sequence
 2D structure Publications