v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pseudomonas sp. SAM-I sequence secondary structure diagram

Pseudomonas sp. SAM-I sequence URS00002D29F6_306

  • 118 nucleotides
  • 1 database (RiboCentre)
  • Found in 3 other species
  • ncRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCUUAUCAAGAGAAGCAGAGGGACUGGCCCGACGAAGCUUCAGCAACCGGUGUAAUGGCGAUCAGCCAUGACCAAGGUGCUAAAUCCAGCAAGCUCGAACAGCUUGGAAGAUAAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Bacillus subtilis SAM riboswitch (S box leader)
  2. Bacillus subtilis subsp. subtilis str. 168 SAM riboswitch (S box leader)
  3. Pseudomonas sp. EGD-AK9 SAM riboswitch (S box leader)
 2D structure