Homo sapiens (human) hsa-miR-548ac

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548ac URS00002CE0C6_9606

22 nucleotides
4 databases (ENA, GeneCards, miRBase, RefSeq)
Found in 0 other species
31 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548ac: Hsa-mir-548ac is a microRNA that was measured in a study along with CD58 and other reference genes [PMC6382214]. CD58 is a mRNA that was measured using the assay identifier Hs01560660_m1 [PMC6382214]. Hsa-mir-548ac and CD58 are both processed from the same primary transcript [PMC6382214]. Additionally, GAPDH was used as a reference gene in the study [PMC6382214]. Hsa-miR-191-5p was also used as a reference miRNA in the study, with the identifier 002299 [PMC6382214].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAAAAACCGGCAAUUACUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications