Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4762-5p URS00002CAB63_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4762: Hsa-mir-4762 is one of the four miRNA genes identified in the study that contains polymorphisms overlapping both the Drosha and Dicer cleavage site [PMC4299713]. A prognostic prediction model of 4-miRNA expression signatures, including hsa-mir-4762, was established using the Cox risk proportional regression model [PMC8797695]. Hsa-miR-190b, hsa-miR-3170, hsa-mir-4762, and hsa-miR-18a were found to be highly expressed in high-risk patients, particularly hsa-miR-18a [PMC8797695]. These four miRNAs were identified as independent prognostic indicators of sarcoma [PMC8797695]. Hsa-mir-4762 was found to target the RUNX1 gene along with hsa-miR-18a [PMC8797695]. No previous reports on hsa-miR-190b and hsa-mir-4762 in tumor research have been found [PMC8797695]. Hsa-miR-18a, hsa-miR3170, hsa-mir-4762, and hsa-miR-190b were enriched in sarcoma tissue samples and played important roles in cancer prognosis [PMC8797695]. The expression of hsa-miR-190b, hsa-miR-3170, and hsa-mir-4762 was higher in low-risk patients [PMC8797695]. The four identified miRNAs were found to have target genes that were filtered as degradation targets based on their interactions with other genes [PMC8797695].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAAAUCUUGAUCAGAAGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications