v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Peribacillus huizhouensis tRNA-Asp secondary structure diagram

Peribacillus huizhouensis tRNA-Asp URS00002C7A07_1501239

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCGGUAGUUCAGUUGGUUAGAAUGCCUGCCUGUCACGCAGGAGGUCGCGGGUUCGAGUCCCGUCCGGACCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,493 other species

  1. Acinetobacter baumannii tRNA-Asp
  2. Aeromicrobium ponti tRNA-Asp
  3. Agaribacter marinus tRNA-Asp
  4. Alcaligenes phenolicus tRNA-Asp
  5. Alkalibacillus almallahensis tRNA-Asp
  6. Alkalibacillus filiformis tRNA-Asp
  7. Alkalibacillus flavidus tRNA-Asp
  8. Alkalibacillus haloalkaliphilus tRNA-Asp
  9. Alkalibacillus salilacus tRNA-Asp
  10. Alkalibacillus silvisoli tRNA-Asp
  11. Alkalibacillus sp. S2W tRNA-Asp
  12. Alkalicoccobacillus gibsonii tRNA-Asp
  13. Alkalicoccobacillus murimartini tRNA-Asp
  14. Alkalihalobacillus alcalophilus tRNA-Asp
  15. Alkalihalobacillus phoenicis tRNA-Asp
  16. Shouchella hunanensis tRNA-Asp
  17. Alkalihalophilus pseudofirmus tRNA-Asp
  18. Alkalihalobacillus sp. FSL R5-0424 tRNA-Asp
  19. Alkalihalobacillus sp. FSL W8-0930 tRNA-Asp
  20. Alkalihalobacillus sp. LMS39 tRNA-Asp
  21. Alkalihalobacillus sp. LMS6 tRNA-Asp
  22. Alkalihalobacillus sp. MEB130 tRNA-Asp
  23. Alkalihalobacillus sp. NPDC078480 tRNA-Asp
  24. Alkalihalobacillus sp. NPDC078783 tRNA-Asp
  25. Alkalihalobacillus sp. NPDC127517 tRNA-Asp
  26. Alkalihalobacillus sp. SIMBA_132 tRNA-Asp
  27. Alkalihalophilus lindianensis tRNA-Asp
  28. Alkalihalophilus marmarensis tRNA-Asp
  29. Alkalihalophilus pseudofirmus OF4 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  30. Alkalihalophilus sp. As8PL tRNA-Asp
  31. Allobacillus halotolerans tRNA-Asp
  32. Allobacillus sp. GCM10007489 tRNA-Asp
  33. Allobacillus sp. GCM10007490 tRNA-Asp
  34. Allobacillus sp. GCM10007491 tRNA-Asp
  35. Allobacillus sp. SKP2-8 tRNA-Asp
  36. Allobacillus salarius tRNA-Asp
  37. Allobacillus saliphilus tRNA-Asp
  38. Amphibacillus cookii tRNA-Asp
  39. Amphibacillus indicireducens tRNA-Asp
  40. Amphibacillus marinus tRNA_Asp_GTC
  41. Amphibacillus sp. (anaerobic digester metagenome) tRNA-Asp
  42. Amphibacillus sp. LTW-01 tRNA-Asp
  43. Amphibacillus sp. MSJ-3 tRNA-Asp
  44. Amphibacillus sp. Q70 tRNA-Asp
  45. Amphibacillus xylanus NBRC 15112 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  46. Anaerostipes hadrus tRNA-Asp
  47. Aquibacillus albus tRNA-Asp
  48. Aquibacillus halophilus tRNA-Asp
  49. Aquibacillus koreensis tRNA-Asp
  50. Aquibacillus rhizosphaerae tRNA-Asp
  51. Aquibacillus salsiterrae tRNA-Asp
  52. Aciduricibacillus chroicocephali tRNA-Asp
  53. Bacillaceae bacterium (coal metagenome) tRNA-Asp
  54. Pradoshia eiseniae tRNA-Asp
  55. Bacillaceae bacterium HSR45 tRNA-Asp
  56. Fervidibacillus albus tRNA-Asp
  57. Fervidibacillus halotolerans tRNA-Asp
  58. Bacillaceae bacterium S4-13-56 tRNA-Asp
  59. Bacillaceae bacterium S4-13-58 tRNA-Asp
  60. Bacillaceae bacterium SAOS 7 tRNA-Asp
  61. Bacillaceae bacterium SAS-127 tRNA-Asp
  62. Radiobacillus deserti tRNA-Asp
  63. Bacillaceae bacterium W0354 tRNA-Asp
  64. Bacilli bacterium tRNA-Asp
  65. Bacilli bacterium VT-13-104 tRNA-Asp
  66. Bacillota bacterium Lsc_1132 tRNA-Asp
  67. Bacillota bacterium tRNA-Asp
  68. Bacillus aerius tRNA-Asp
  69. Bacillus aerophilus tRNA-Asp
  70. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Asp
  71. Bacillus altitudinis 41KF2b tRNA-Asp
  72. Bacillus altitudinis A23-8 tRNA-Asp
  73. Bacillus altitudinis C101 tRNA-Asp
  74. Bacillus altitudinis C16B11 tRNA-Asp
  75. Bacillus altitudinis MN12 tRNA-Asp
  76. Bacillus altitudinis S70-5-12 tRNA-Asp
  77. Bacillus altitudinis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  78. Bacillus amyloliquefaciens CC178 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  79. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  80. Bacillus amyloliquefaciens EBL11 tRNA-Asp
  81. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Asp
  82. Bacillus amyloliquefaciens IT-45 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  83. Bacillus amyloliquefaciens KHG19 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  84. Bacillus amyloliquefaciens LFB112 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  85. Bacillus amyloliquefaciens LL3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  86. Bacillus amyloliquefaciens TA208 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  87. Bacillus amyloliquefaciens tRNA-Asp(gtc)
  88. Bacillus amyloliquefaciens UASWS BA1 tRNA-Asp
  89. Bacillus amyloliquefaciens UMAF6614 tRNA-Asp
  90. Bacillus amyloliquefaciens UMAF6639 tRNA-Asp
  91. Bacillus amyloliquefaciens XH7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  92. Bacillus atrophaeus 1942 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  93. Bacillus atrophaeus ATCC 9372 tRNA-Asp
  94. Bacillus atrophaeus C89 tRNA-Asp
  95. Bacillus atrophaeus subsp. globigii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  96. Bacillus atrophaeus tRNA-Asp
  97. Bacillus australimaris tRNA-Asp
  98. Bacillus ayatagriensis tRNA-Asp
  99. Bacillus cabrialesii subsp. cabrialesii tRNA-Asp
  100. Bacillus cabrialesii subsp. tritici tRNA-Asp
  101. Bacillus cabrialesii tRNA-Asp
  102. Bacillus capparidis tRNA-Asp
  103. Bacillus carboniphilus tRNA-Asp
  104. Bacillus altitudinis tRNA-Asp
  105. Bacillus cereus tRNA-Asp
  106. Bacillus changyiensis tRNA-Asp
  107. Niallia circulans tRNA-Asp(gtc)
  108. Bacillus crepusculi tRNA-Asp
  109. Cytobacillus dafuensis tRNA-Asp
  110. Cytobacillus depressus tRNA-Asp
  111. Bacillus ectoiniformans tRNA-Asp
  112. [Bacillus] enclensis tRNA_Asp_GTC
  113. Niallia endozanthoxylica tRNA-Asp
  114. Bacillus firmis tRNA-Asp
  115. Cytobacillus firmus DS1 tRNA-Asp
  116. Bacillus glycinifermentans tRNA-Asp
  117. Bacillus gobiensis tRNA-Asp
  118. Bacillus haikouensis tRNA-Asp
  119. Bacillus halotolerans tRNA-Asp
  120. Bacillus haynesii tRNA-Asp
  121. Bacillus inaquosorum tRNA-Asp(gtc)
  122. Bacillus spizizenii tRNA-Asp
  123. Halalkalibacter krulwichiae tRNA-Asp
  124. Robertmurraya kyonggiensis tRNA-Asp
  125. Shouchella lehensis tRNA-Asp
  126. Bacillus licheniformis CG-B52 tRNA-Asp
  127. Bacillus [licheniformis] CMCC 63516 tRNA-Asp
  128. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  129. Bacillus licheniformis LMG 17339 tRNA-Asp
  130. Bacillus licheniformis LMG 6934 tRNA-Asp
  131. Bacillus licheniformis LMG 7559 tRNA-Asp
  132. Bacillus licheniformis tRNA-Asp(gtc)
  133. Bacillus licheniformis WX-02 tRNA-Asp
  134. Peribacillus loiseleuriae tRNA-Asp
  135. Bacillus lumedeiriae tRNA-Asp
  136. Rossellomorea marisflavi tRNA-Asp
  137. Alkalihalophilus marmarensis DSM 21297 tRNA-Asp
  138. Priestia megaterium tRNA-Asp
  139. Bacillus mesophilum tRNA-Asp
  140. Bacillus mexicanus tRNA-Asp
  141. Bacillus mobilis tRNA-Asp
  142. Bacillus mojavensis RO-H-1 = KCTC 3706 tRNA-Asp
  143. Bacillus mojavensis tRNA-Asp
  144. Bacillus nakamurai tRNA-Asp
  145. Halalkalibacter nanhaiisediminis tRNA-Asp
  146. Niallia nealsonii AAU1 tRNA-Asp
  147. Niallia nealsonii tRNA-Asp
  148. Neobacillus notoginsengisoli tRNA-Asp
  149. Bacillus obstructivus tRNA-Asp
  150. Cytobacillus oceanisediminis 2691 tRNA-Asp
  151. Halalkalibacter okhensis tRNA-Asp
  152. Halalkalibacterium halodurans tRNA-Asp
  153. Bacillus oleivorans tRNA-Asp
  154. Bacillus paralicheniformis ATCC 9945a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  155. Bacillus paralicheniformis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  156. Alkalicoccobacillus plakortidis tRNA-Asp
  157. Alkalihalobacillus pseudalcaliphilus tRNA-Asp
  158. Alkalihalophilus pseudofirmus tRNA-Asp
  159. Bacillus pumilus ATCC 7061 tRNA-Asp
  160. Bacillus pumilus DW2J2 tRNA-Asp
  161. Bacillus pumilus SAFR-032 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  162. Bacillus pumilus sxm20-2 tRNA-Asp
  163. Bacillus pumilus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  164. Bacillus rugosus tRNA-Asp
  165. Bacillus safensis FO-36b tRNA-Asp
  166. Bacillus safensis subsp. osmophilus tRNA-Asp
  167. Bacillus safensis subsp. safensis tRNA-Asp(gtc)
  168. Bacillus safensis tRNA-Asp(gtc)
  169. Bacillus seohaeanensis tRNA-Asp
  170. Bacillus siamensis tRNA-Asp
  171. Bacillus solimangrovi tRNA-Asp
  172. Bacillus sonorensis L12 tRNA-Asp
  173. Bacillus sonorensis tRNA-Asp
  174. Bacillus sp. 005/A4HT-01/001 tRNA-Asp
  175. Bacillus sp. 0102A tRNA-Asp
  176. Bacillus sp. 0209A tRNA-Asp
  177. Bacillus sp. 0909A tRNA-Asp
  178. Bacillus sp. 1006-3 tRNA-Asp
  179. Bacillus sp. 1021 tRNA-Asp
  180. Bacillus sp. 153480031-1 tRNA-Asp
  181. Bacillus sp. 153480037-1 tRNA-Asp
  182. Bacillus sp. 1735sda2 tRNA-Asp
  183. Bacillus sp. 179-C3.3 HS tRNA-Asp
  184. Bacillus sp. BSDF18-5 Bacillus sp. 18-5 tRNA-Asp
  185. Bacillus sp. 1NLA3E tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  186. Bacillus sp. 1s-1 tRNA-Asp
  187. Bacillus sp. 2211 tRNA-Asp
  188. Bacillus sp. 22190 tRNA-Asp
  189. Bacillus sp. 22266 tRNA-Asp
  190. Bacillus sp. 22293 tRNA-Asp
  191. Bacillus sp. 22446 tRNA-Asp
  192. Bacillus sp. 22483 tRNA-Asp
  193. Bacillus sp. 275 tRNA-Asp
  194. Bacillus sp. 2_A_57_CT2 tRNA-Asp
  195. Bacillus sp. 2CMS4F tRNA-Asp
  196. Bacillus sp. 31 tRNA-Asp
  197. Bacillus sp. 348 tRNA-Asp
  198. Bacillus sp. 349Y tRNA-Asp
  199. Bacillus sp. 3A_MP1 tRNA-Asp
  200. Bacillus sp. 3a tRNA-Asp
  201. Bacillus sp. 4A_MP2 tRNA-Asp
  202. Bacillus sp. 4A_MP3 tRNA-Asp
  203. Bacillus sp. 5001 tRNA-Asp
  204. Bacillus sp. 5B6 tRNA-Asp
  205. Bacillus sp. 7504-2 tRNA-Asp
  206. Bacillus sp. 7520-S tRNA-Asp
  207. Bacillus sp. 7788 tRNA-Asp
  208. Bacillus sp. 7884-1 tRNA-Asp
  209. Bacillus sp. 7D3 tRNA-Asp
  210. Bacillus sp. 8A6 tRNA-Asp
  211. Bacillus sp. 916 tRNA-Asp
  212. Bacillus sp. 9J tRNA-Asp
  213. Bacillus sp. A015 tRNA-Asp
  214. Bacillus sp. A053 tRNA-Asp
  215. Bacillus sp. A1 tRNA-Asp
  216. Bacillus sp. A31 tRNA-Asp
  217. Bacillus sp. AAVF1 tRNA-Asp
  218. Bacillus sp. AF12 tRNA-Asp
  219. Bacillus sp. AF23 tRNA-Asp
  220. Bacillus sp. AF42 tRNA-Asp
  221. Bacillus sp. AFS006103 tRNA-Asp
  222. Bacillus sp. AFS015802 tRNA-Asp
  223. Bacillus sp. AFS031507 tRNA-Asp
  224. Bacillus sp. AFS040349 tRNA-Asp
  225. Bacillus sp. AFS073361 tRNA-Asp
  226. Bacillus sp. AG1 tRNA-Asp
  227. Bacillus sp. AK031 tRNA-Asp
  228. Bacillus sp. AK124 tRNA-Asp
  229. Bacillus sp. AK130 tRNA-Asp
  230. Bacillus sp. AK25 tRNA-Asp
  231. Bacillus sp. alh8 tRNA-Asp
  232. Bacillus sp. AM1(2019) tRNA-Asp
  233. Bacillus sp. AM 13(2015) (2015) tRNA-Asp
  234. Bacillus sp. AN2 tRNA-Asp
  235. Bacillus sp. AnS8 tRNA-Asp
  236. Bacillus sp. ANT_WA51 tRNA-Asp
  237. Bacillus sp. AR11 tRNA-Asp
  238. Bacillus sp. ATD tRNA-Asp
  239. Bacillus sp. Au-Bac7 tRNA-Asp
  240. Bacillus siamensis Bacillus sp. B01(2024) tRNA-Asp
  241. Bacillus sp. B088 tRNA-Asp
  242. Bacillus sp. B1(2022) tRNA-Asp
  243. Bacillus sp. B15-48 tRNA-Asp
  244. Bacillus sp. B18(2022) tRNA-Asp
  245. Bacillus sp. B19-2 tRNA-Asp
  246. Bacillus sp. B1-b2 tRNA-Asp
  247. Bacillus sp. B2(2022) tRNA-Asp
  248. Bacillus sp. B28 tRNA-Asp
  249. Bacillus sp. B38 tRNA-Asp
  250. Bacillus sp. B6(2022) tRNA-Asp
  251. Bacillus sp. B8(2022) tRNA-Asp
  252. Bacillus sp. BACIII tRNA-Asp
  253. Bacillus sp. BAC tRNA-Asp
  254. Bacillus sp. BC1-43 tRNA-Asp
  255. Bacillus sp. BD48 tRNA-Asp
  256. Bacillus sp. BH072 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  257. Bacillus sp. BHET2 tRNA-Asp
  258. Bacillus sp. B-jedd tRNA-Asp
  259. Bacillus sp. BMG-18 tRNA-Asp
  260. Bacillus sp. B.PNR1 tRNA-Asp
  261. Bacillus sp. B.PNR2 tRNA-Asp
  262. Bacillus sp. BR_10 tRNA-Asp
  263. Bacillus sp. BS1807G30 tRNA-Asp
  264. Bacillus sp. BS3(2021) tRNA-Asp
  265. Bacillus sp. BT1B_CT2 tRNA-Asp
  266. Cytobacillus sp. Bva_UNVM-123 Bacillus sp. Bva_UNVM-123 tRNA-Asp
  267. Bacillus sp. Bvel1 tRNA-Asp
  268. Bacillus sp. Bwzl_19 tRNA-Asp
  269. Bacillus sp. C10(2022) tRNA-Asp
  270. Bacillus sp. C11(2022) tRNA-Asp
  271. Bacillus sp. C1-1 tRNA-Asp
  272. Bacillus sp. C1(2022) tRNA-Asp
  273. Bacillus sp. C15(2022) tRNA-Asp
  274. Bacillus sp. C15 tRNA-Asp
  275. Bacillus sp. C21 tRNA-Asp
  276. Bacillus sp. C2(2022) tRNA-Asp
  277. Bacillus sp. C28GYM-DRY-1 tRNA-Asp
  278. Bacillus sp. C3(2022) tRNA-Asp
  279. Bacillus sp. C37plca tRNA-Asp
  280. Bacillus sp. C5(2022) tRNA-Asp
  281. Bacillus sp. CCNWLCWHY013 tRNA-Asp
  282. Bacillus sp. CECT 9360 tRNA-Asp
  283. Bacillus sp. CH30_1T tRNA-Asp
  284. Bacillus sp. ChL18 tRNA-Asp
  285. Bacillus sp. CIS52 tRNA-Asp
  286. Bacillus sp. CJ1 tRNA-Asp
  287. Bacillus sp. CJCL2 tRNA-Asp
  288. Bacillus sp. CMAA 1185 tRNA-Asp
  289. Bacillus sp. CMF12 tRNA-Asp
  290. Bacillus sp. CN2 tRNA-Asp
  291. Bacillus sp. CPSM8 tRNA-Asp
  292. Bacillus sp. CRN 9 tRNA-Asp
  293. Bacillus aerolatus tRNA-Asp
  294. Bacillus sp. D12 tRNA-Asp
  295. Bacillus sp. D7-8 tRNA-Asp
  296. Bacillus sp. DFXJ5 tRNA-Asp
  297. Bacillus sp. DFXJR3 tRNA-Asp
  298. Bacillus sp. DFXYC7 tRNA-Asp
  299. Bacillus sp. DM2 tRNA-Asp
  300. Bacillus sp. DNRA2 tRNA-Asp
  301. Bacillus sp. DR8(2025) tRNA-Asp
  302. Metabacillus sediminilitoris tRNA-Asp
  303. Bacillus sp. DSM 27956 tRNA-Asp
  304. Bacillus sp. DTU_2020_1000418_1_SI_GHA_SEK_038 tRNA-Asp
  305. Bacillus sp. EB106-04-04-XG123 tRNA-Asp
  306. Bacillus sp. EB106-06-01-XG163 tRNA-Asp
  307. Bacillus sp. EB106-08-02-XG196 tRNA-Asp
  308. Bacillus sp. EB106-09-04-XG55 tRNA-Asp
  309. Bacillus sp. EKM208B tRNA-Asp
  310. Bacillus sp. EKM213B tRNA-Asp
  311. Bacillus sp. EKM417B tRNA-Asp
  312. Bacillus sp. EKM420B tRNA-Asp
  313. Bacillus sp. es.034 tRNA-Asp
  314. Bacillus sp. ESY73 tRNA-Asp
  315. Bacillus sp. ESY92 tRNA-Asp
  316. Bacillus sp. EU52 tRNA-Asp
  317. Bacillus sp. EU55 tRNA-Asp
  318. Bacillus sp. EU62 tRNA-Asp
  319. Bacillus sp. EU63 tRNA-Asp
  320. Bacillus sp. F1-12(2026) tRNA-Asp
  321. Bacillus sp. F2HM tRNA-Asp
  322. Bacillus sp. FCW2 tRNA-Asp
  323. Bacillus sp. FJAT-14266 tRNA-Asp
  324. Bacillus sp. FJAT-21945 tRNA-Asp
  325. Bacillus sp. FJAT-21955 tRNA-Asp
  326. Bacillus sp. FJAT-27001 tRNA-Asp
  327. Bacillus sp. FJAT-27231 tRNA-Asp
  328. Bacillus sp. FJAT-27445 tRNA-Asp
  329. Bacillus sp. FJAT-27916 tRNA-Asp
  330. Bacillus sp. FJAT-27986 tRNA-Asp
  331. Bacillus sp. FJAT-29790 tRNA-Asp
  332. Bacillus sp. FJAT-42376 tRNA-Asp
  333. Bacillus sp. FJAT-49711 tRNA-Asp
  334. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Asp
  335. Bacillus sp. FJAT-53060 tRNA-Asp
  336. Bacillus sp. FMQ74 tRNA-Asp
  337. Bacillus sp. FSL E2-0174 tRNA-Asp
  338. Bacillus sp. FSL H7-0578 tRNA-Asp
  339. Bacillus sp. FSL H8-0512 tRNA-Asp
  340. Bacillus sp. FSL H8-0515 tRNA-Asp
  341. Bacillus sp. FSL H8-0516 tRNA-Asp
  342. Bacillus sp. FSL K6-0036 tRNA-Asp
  343. Bacillus sp. FSL K6-0046 tRNA-Asp
  344. Bacillus sp. FSL K6-0047 tRNA-Asp
  345. Bacillus sp. FSL K6-0138 tRNA-Asp
  346. Bacillus sp. FSL K6-0250 tRNA-Asp
  347. Bacillus sp. FSL K6-0255 tRNA-Asp
  348. Bacillus sp. FSL K6-0764 tRNA-Asp
  349. Bacillus sp. FSL K6-0923 tRNA-Asp
  350. Bacillus sp. FSL K6-0947 tRNA-Asp
  351. Bacillus sp. FSL K6-0972 tRNA-Asp
  352. Bacillus sp. FSL K6-0993 tRNA-Asp
  353. Bacillus sp. FSL K6-0994 tRNA-Asp
  354. Bacillus sp. FSL K6-0998 tRNA-Asp
  355. Bacillus sp. FSL K6-1000 tRNA-Asp
  356. Bacillus sp. FSL K6-1003 tRNA-Asp
  357. Bacillus sp. FSL K6-1005 tRNA-Asp
  358. Bacillus sp. FSL K6-1006 tRNA-Asp
  359. Bacillus sp. FSL K6-1012 tRNA-Asp
  360. Bacillus sp. FSL K6-1033 tRNA-Asp
  361. Bacillus sp. FSL K6-1106 tRNA-Asp
  362. Bacillus sp. FSL K6-1109 tRNA-Asp
  363. Bacillus sp. FSL K6-1145 tRNA-Asp
  364. Bacillus sp. FSL K6-1234 tRNA-Asp
  365. Bacillus sp. FSL K6-1284 tRNA-Asp
  366. Bacillus sp. FSL K6-1336 tRNA-Asp
  367. Bacillus sp. FSL K6-1366 tRNA-Asp
  368. Bacillus sp. FSL K6-1560 tRNA-Asp
  369. Bacillus sp. FSL K6-2431 tRNA-Asp
  370. Bacillus sp. FSL K6-2819 tRNA-Asp
  371. Bacillus sp. FSL K6-2837 tRNA-Asp
  372. Bacillus sp. FSL K6-2839 tRNA-Asp
  373. Bacillus sp. FSL K6-2841 tRNA-Asp
  374. Bacillus sp. FSL K6-2860 tRNA-Asp
  375. Bacillus sp. FSL K6-2861 tRNA-Asp
  376. Bacillus sp. FSL K6-2865 tRNA-Asp
  377. Bacillus sp. FSL K6-2869 tRNA-Asp
  378. Bacillus sp. FSL K6-2971 tRNA-Asp
  379. Bacillus sp. FSL K6-3149 tRNA-Asp
  380. Bacillus sp. FSL K6-3154 tRNA-Asp
  381. Bacillus sp. FSL K6-3176 tRNA-Asp
  382. Bacillus sp. FSL K6-3200 tRNA-Asp
  383. Bacillus sp. FSL K6-3221 tRNA-Asp
  384. Bacillus sp. FSL K6-3312 tRNA-Asp
  385. Bacillus sp. FSL K6-3458 tRNA-Asp
  386. Bacillus sp. FSL K6-3459 tRNA-Asp
  387. Bacillus sp. FSL K6-3846 tRNA-Asp
  388. Bacillus sp. FSL K6-4563 tRNA-Asp
  389. Bacillus sp. FSL K6-5915 tRNA-Asp
  390. Bacillus sp. FSL K6-6483 tRNA-Asp
  391. Bacillus sp. FSL K6-6540 tRNA-Asp
  392. Bacillus sp. FSL K6-8391 tRNA-Asp
  393. Bacillus sp. FSL L8-0167 tRNA-Asp
  394. Bacillus sp. FSL L8-0173 tRNA-Asp
  395. Bacillus sp. FSL L8-0186 tRNA-Asp
  396. Bacillus sp. FSL L8-0193 tRNA-Asp
  397. Bacillus sp. FSL L8-0215 tRNA-Asp
  398. Bacillus sp. FSL L8-0222 tRNA-Asp
  399. Bacillus sp. FSL L8-0358 tRNA-Asp
  400. Bacillus sp. FSL L8-0528 tRNA-Asp
  401. Bacillus sp. FSL L8-0533 tRNA-Asp
  402. Bacillus sp. FSL L8-0654 tRNA-Asp
  403. Bacillus sp. FSL L8-0661 tRNA-Asp
  404. Bacillus sp. FSL M7-0003 tRNA-Asp
  405. Bacillus sp. FSL M7-0307 tRNA-Asp
  406. Bacillus sp. FSL M7-0417 tRNA-Asp
  407. Bacillus sp. FSL M7-0558 tRNA-Asp
  408. Bacillus sp. FSL M7-0791 tRNA-Asp
  409. Bacillus sp. FSL M7-1004 tRNA-Asp
  410. Bacillus sp. FSL M8-0025 tRNA-Asp
  411. Bacillus sp. FSL M8-0049 tRNA-Asp
  412. Bacillus sp. FSL M8-0052 tRNA-Asp
  413. Bacillus sp. FSL M8-0054 tRNA-Asp
  414. Bacillus sp. FSL M8-0071 tRNA-Asp
  415. Bacillus sp. FSL M8-0077 tRNA-Asp
  416. Bacillus sp. FSL M8-0133 tRNA-Asp
  417. Bacillus sp. FSL M8-0166 tRNA-Asp
  418. Bacillus sp. FSL M8-0168 tRNA-Asp
  419. Bacillus sp. FSL M8-0256 tRNA-Asp
  420. Bacillus sp. FSL M8-0266 tRNA-Asp
  421. Bacillus sp. FSL M8-0277 tRNA-Asp
  422. Bacillus sp. FSL M8-0315 tRNA-Asp
  423. Bacillus sp. FSL M8-0326 tRNA-Asp
  424. Bacillus sp. FSL M8-0350 tRNA-Asp
  425. Bacillus sp. FSL M8-0359 tRNA-Asp
  426. Bacillus sp. FSL P2-0026 tRNA-Asp
  427. Bacillus sp. FSL P2-0069 tRNA-Asp
  428. Bacillus sp. FSL P2-0092 tRNA-Asp
  429. Bacillus sp. FSL P4-0248 tRNA-Asp
  430. Bacillus sp. FSL P4-0290 tRNA-Asp
  431. Bacillus sp. FSL P4-0322 tRNA-Asp
  432. Bacillus sp. FSL P4-0334 tRNA-Asp
  433. Bacillus sp. FSL R5-0286 tRNA-Asp
  434. Bacillus sp. FSL R5-0293 tRNA-Asp
  435. Bacillus sp. FSL R5-0394 tRNA-Asp
  436. Bacillus sp. FSL R5-0397 tRNA-Asp
  437. Bacillus sp. FSL R5-0416 tRNA-Asp
  438. Bacillus sp. FSL R5-0418 tRNA-Asp
  439. Bacillus sp. FSL R5-0422 tRNA-Asp
  440. Bacillus sp. FSL R5-0431 tRNA-Asp
  441. Bacillus sp. FSL R5-0432 tRNA-Asp
  442. Bacillus sp. FSL R5-0434 tRNA-Asp
  443. Bacillus sp. FSL R5-0439 tRNA-Asp
  444. Bacillus sp. FSL R5-0443 tRNA-Asp
  445. Bacillus sp. FSL R5-0447 tRNA-Asp
  446. Bacillus sp. FSL R5-0512 tRNA-Asp
  447. Bacillus sp. FSL R5-0523 tRNA-Asp
  448. Bacillus sp. FSL R5-0560 tRNA-Asp
  449. Bacillus sp. FSL R5-0576 tRNA-Asp
  450. Bacillus sp. FSL R5-0586 tRNA-Asp
  451. Bacillus sp. FSL R5-0593 tRNA-Asp
  452. Bacillus sp. FSL R5-0603 tRNA-Asp
  453. Bacillus sp. FSL R5-0654 tRNA-Asp
  454. Bacillus sp. FSL R5-0659 tRNA-Asp
  455. Bacillus sp. FSL R5-0712 tRNA-Asp
  456. Bacillus sp. FSL R5-0820 tRNA-Asp
  457. Bacillus sp. FSL R7-0166 tRNA-Asp
  458. Bacillus sp. FSL R7-0229 tRNA-Asp
  459. Bacillus sp. FSL R7-0646 tRNA-Asp
  460. Bacillus sp. FSL R7-0651 tRNA-Asp
  461. Bacillus sp. FSL R7-0672 tRNA-Asp
  462. Bacillus sp. FSL R7-0675 tRNA-Asp
  463. Bacillus sp. FSL R7-0685 tRNA-Asp
  464. Bacillus sp. FSL R7-0718 tRNA-Asp
  465. Bacillus sp. FSL W7-1034 tRNA-Asp
  466. Bacillus sp. FSL W7-1085 tRNA-Asp
  467. Bacillus sp. FSL W7-1092 tRNA-Asp
  468. Bacillus sp. FSL W7-1282 tRNA-Asp
  469. Bacillus sp. FSL W7-1321 tRNA-Asp
  470. Bacillus sp. FSL W7-1336 tRNA-Asp
  471. Bacillus sp. FSL W7-1346 tRNA-Asp
  472. Bacillus sp. FSL W7-1354 tRNA-Asp
  473. Bacillus sp. FSL W7-1360 tRNA-Asp
  474. Bacillus sp. FSL W7-1582 tRNA-Asp
  475. Bacillus sp. FSL W8-0006 tRNA-Asp
  476. Bacillus sp. FSL W8-0183 tRNA-Asp
  477. Bacillus sp. FSL W8-0445 tRNA-Asp
  478. Bacillus sp. FSL W8-0502 tRNA-Asp
  479. Bacillus sp. FSL W8-0629 tRNA-Asp
  480. Bacillus sp. FSL W8-0645 tRNA-Asp
  481. Bacillus sp. FSL W8-0672 tRNA-Asp
  482. Bacillus sp. FSL W8-0812 tRNA-Asp
  483. Bacillus sp. FSL W8-0848 tRNA-Asp
  484. Bacillus sp. FSL W8-0920 tRNA-Asp
  485. Bacillus sp. FSL W8-0940 tRNA-Asp
  486. Bacillus sp. FSL W8-1122 tRNA-Asp
  487. Bacillus sp. FSL W8-1141 tRNA-Asp
  488. Bacillus sp. FSL W8-1143 tRNA-Asp
  489. Bacillus sp. FSL W8-1202 tRNA-Asp
  490. Bacillus sp. FW1 tRNA-Asp
  491. Bacillus sp. G1(2015b) (2015b) tRNA-Asp
  492. Bacillus sp. G16 tRNA-Asp
  493. Bacillus sp. G402 tRNA-Asp
  494. Bacillus sp. GBSC66 tRNA-Asp
  495. Bacillus sp. GBSW19 tRNA-Asp
  496. Bacillus sp. GBSW2 tRNA-Asp
  497. Bacillus sp. Gen2 tRNA-Asp
  498. Bacillus sp. Gen3 tRNA-Asp
  499. Bacillus sp. GG161 tRNA-Asp
  500. Bacillus sp. GM1 tRNA-Asp
  501. Bacillus sp. GM2 tRNA-Asp
  502. Bacillus sp. GZB tRNA-Asp
  503. Bacillus sp. H15-1 tRNA-Asp
  504. Bacillus sp. H1F1 tRNA-Asp
  505. Bacillus sp. H2FL2 tRNA-Asp
  506. Bacillus sp. HB022 tRNA-Asp
  507. Bacillus sp. Hm123 tRNA-Asp
  508. Bacillus salinus tRNA-Asp
  509. Bacillus sp. HMG tRNA-Asp
  510. Bacillus sp. HN03 tRNA-Asp
  511. Bacillus sp. HNA3 tRNA-Asp
  512. Bacillus sp. HSf4 tRNA-Asp
  513. Bacillus sp. HU-1818 tRNA-Asp
  514. Bacillus sp. I-2 tRNA-Asp
  515. Metabacillus arenae tRNA-Asp
  516. Bacillus sp. ICE1 tRNA-Asp
  517. Bacillus sp. IG2 tRNA-Asp
  518. Bacillus sp. IG6 tRNA-Asp
  519. Bacillus sp. IITD106 tRNA-Asp
  520. Bacillus sp. (in: firmicutes) tRNA-Asp
  521. Bacillus sp. IS1 tRNA-Asp
  522. Bacillus sp. ISL-18 tRNA-Asp
  523. Bacillus sp. ISL-26 tRNA-Asp
  524. Bacillus sp. ISL-32 tRNA-Asp
  525. Bacillus sp. ISL-40 tRNA-Asp
  526. Bacillus sp. ISL-46 tRNA-Asp
  527. Bacillus sp. ISL-47 tRNA-Asp
  528. Bacillus sp. ISL-51 tRNA-Asp
  529. Bacillus sp. ISL-75 tRNA-Asp
  530. Bacillus sp. ISL-77 tRNA-Asp
  531. Bacillus sp. ISL-7 tRNA-Asp
  532. Bacillus sp. iso_77 tRNA-Asp
  533. Bacillus sp. IT-13CA1 tRNA-Asp
  534. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Asp
  535. Bacillus spizizenii str. W23 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  536. Bacillus spizizenii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  537. Bacillus spizizenii TU-B-10 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  538. Bacillus sp. J14 tRNA-Asp
  539. Bacillus sp. J14TS2 tRNA-Asp
  540. Bacillus sp. J41TS8 tRNA-Asp
  541. Bacillus sp. J5TS4 tRNA-Asp
  542. Bacillus sp. Je.9.29.b tRNA-Asp
  543. Bacillus sp. JHAA tRNA-Asp
  544. Bacillus sp. JJ1474 tRNA-Asp
  545. Bacillus sp. JJ1503 tRNA-Asp
  546. Bacillus sp. JJ1532 tRNA-Asp
  547. Bacillus sp. JJ1773 tRNA-Asp
  548. Bacillus sp. JJ353 tRNA-Asp
  549. Bacillus sp. JJ634 tRNA-Asp
  550. Bacillus sp. JJ675 tRNA-Asp
  551. Bacillus sp. JK106 tRNA-Asp
  552. Bacillus sp. JK127 tRNA-Asp
  553. Bacillus sp. JK62 tRNA-Asp
  554. Bacillus sp. JK74 tRNA-Asp
  555. Bacillus sp. JNUCC-21 tRNA-Asp
  556. Bacillus sp. JNUCC-22 tRNA-Asp
  557. Bacillus sp. JNUCC-24 tRNA-Asp
  558. Bacillus sp. JRC01 tRNA-Asp
  559. Bacillus sp. JS tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  560. Bacillus sp. JUb11 tRNA-Asp
  561. Bacillus sp. jun1 tRNA-Asp
  562. Bacillus sp. jun7 tRNA-Asp
  563. Bacillus sp. JZ105 tRNA-Asp
  564. Bacillus sp. JZ109 tRNA-Asp
  565. Bacillus sp. JZ142 tRNA-Asp
  566. Bacillus sp. JZ33 tRNA-Asp
  567. Bacillus sp. JZ34 tRNA-Asp
  568. Bacillus sp. JZ35 tRNA-Asp
  569. Bacillus sp. JZ39 tRNA-Asp
  570. Bacillus sp. JZ71 tRNA-Asp
  571. Bacillus sp. JZ76 tRNA-Asp
  572. Bacillus sp. JZ78 tRNA-Asp
  573. Bacillus sp. K7 tRNA-Asp
  574. Bacillus sp. KBS0812 tRNA-Asp
  575. Bacillus sp. KeR2 tRNA-Asp
  576. Bacillus sp. KH172YL63 tRNA-Asp
  577. Bacillus sp. KICET-1 tRNA-Asp
  578. Bacillus sp. KICET-3 tRNA-Asp
  579. Bacillus sp. KS1 tRNA-Asp
  580. Bacillus sp. L_1B0_12 tRNA-Asp
  581. Bacillus sp. L381 tRNA-Asp
  582. Bacillus sp. LB7 tRNA-Asp
  583. Bacillus sp. LBG-1-113 tRNA-Asp
  584. Bacillus sp. LDHLGR2 tRNA-Asp
  585. Bacillus sp. LDLSCR6 tRNA-Asp
  586. Bacillus sp. LDLSCR9 tRNA-Asp
  587. Bacillus sp. Leaf406 tRNA-Asp
  588. Bacillus sp. Leaf49 tRNA-Asp
  589. Neobacillus massiliamazoniensis tRNA-Asp
  590. Bacillus sp. LJBS06 tRNA-Asp
  591. Bacillus sp. LJBS17 tRNA-Asp
  592. Bacillus sp. LJBV19 tRNA-Asp
  593. Bacillus sp. LK10 tRNA-Asp
  594. Bacillus sp. LK7 tRNA-Asp
  595. Bacillus sp. LL01 tRNA-Asp
  596. Bacillus sp. LLTC93 tRNA-Asp
  597. Bacillus sp. LM 4-2 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  598. Bacillus sp. LMB3902 tRNA-Asp
  599. Bacillus sp. LMT tRNA-Asp
  600. Bacillus sp. LNXM10 tRNA-Asp
  601. Bacillus sp. LNXM12-1 tRNA-Asp
  602. Bacillus sp. LNXM12-2 tRNA-Asp
  603. Bacillus sp. LNXM65 tRNA-Asp
  604. Bacillus sp. LR--39 tRNA-Asp
  605. Bacillus sp. LR_5 tRNA-Asp
  606. Bacillus sp. LR_6 tRNA-Asp
  607. Bacillus sp. LSHTC1 tRNA-Asp
  608. Bacillus sp. LSWJC6 tRNA-Asp
  609. Bacillus sp. LUNF1 tRNA-Asp
  610. Bacillus sp. LYLB4 tRNA-Asp
  611. Bacillus velezensis tRNA-Asp
  612. Bacillus sp. M 2-6 tRNA-Asp
  613. Bacillus sp. MAG717A tRNA-Asp
  614. Bacillus sp. Man122 tRNA-Asp
  615. Bacillus sp. MBGLi79 tRNA-Asp
  616. Bacillus sp. MBGLi97 tRNA-Asp
  617. Bacillus sp. MD-5 tRNA-Asp
  618. Bacillus sp. MFK14 tRNA-Asp
  619. Bacillus sp. MFK6 tRNA-Asp
  620. Bacillus sp. MKU004 tRNA-Asp
  621. Bacillus sp. MM09(2025) tRNA-Asp
  622. Bacillus sp. MM2020_1 tRNA-Asp
  623. Bacillus sp. MM2020_4 tRNA-Asp
  624. Bacillus sp. MMG021 tRNA-Asp
  625. Bacillus sp. MRMR6 tRNA-Asp
  626. Bacillus sp. ms-22 tRNA-Asp
  627. Bacillus sp. MT(2024) tRNA-Asp
  628. Bacillus sp. MT tRNA-Asp
  629. Bacillus sp. MUM 116 tRNA-Asp
  630. Bacillus sp. MZGC1 tRNA-Asp
  631. Bacillus sp. N1(2025) tRNA-Asp
  632. Bacillus sp. N12A5 tRNA-Asp
  633. Bacillus sp. N13C7 tRNA-Asp
  634. Cytobacillus sp. NCCP-133 tRNA-Asp
  635. Bacillus sp. NEAU-16 tRNA-Asp
  636. Bacillus sp. NEAU-242-2 tRNA-Asp
  637. Bacillus sp. NEAU-CP5 tRNA-Asp
  638. Bacillus sp. Nf3 tRNA-Asp
  639. Bacillus sp. NIO_002 tRNA-Asp
  640. Bacillus sp. NMCC46 tRNA-Asp
  641. Bacillus sp. NMCC4 tRNA-Asp
  642. Bacillus sp. NMCN1 tRNA-Asp
  643. Bacillus sp. NMCN6 tRNA-Asp
  644. Bacillus sp. NMTD17 tRNA-Asp
  645. Bacillus sp. NPDC077027 tRNA-Asp
  646. Bacillus sp. NPDC093026 tRNA-Asp
  647. Bacillus sp. NSP9.1 tRNA-Asp
  648. Bacillus sp. NTK034 tRNA-Asp
  649. Bacillus sp. NTK074B tRNA-Asp
  650. Bacillus sp. OAE578 tRNA-Asp
  651. Bacillus sp. OHL2 tRNA-Asp
  652. Bacillus spongiae tRNA-Asp
  653. Bacillus sp. P003 tRNA-Asp
  654. Alkalicoccobacillus porphyridii tRNA-Asp
  655. Bacillus sp. PAMC22265 tRNA-Asp
  656. Bacillus sp. PAMC26543 tRNA-Asp
  657. Bacillus sp. PAMC28571 tRNA-Asp
  658. Bacillus sp. PAMC28748 tRNA-Asp
  659. Bacillus sp. Pc3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  660. Bacillus sp. PCH94 tRNA-Asp
  661. Bacillus sp. PDNC022 tRNA-Asp
  662. Bacillus sp. PK3-037 tRNA-Asp
  663. Bacillus sp. PK3-045 tRNA-Asp
  664. Bacillus sp. PK3-056 tRNA-Asp
  665. Bacillus sp. PK3-130 tRNA-Asp
  666. Bacillus sp. PK3-136 tRNA-Asp
  667. Bacillus sp. PK3-137 tRNA-Asp
  668. Bacillus sp. PK3_68 tRNA-Asp
  669. Bacillus sp. PK5-004 tRNA-Asp
  670. Bacillus sp. PK5-006 tRNA-Asp
  671. Bacillus sp. PK5-009 tRNA-Asp
  672. Bacillus sp. PK5-050 tRNA-Asp
  673. Bacillus sp. PK6-013 tRNA-Asp
  674. Bacillus sp. PK6-025 tRNA-Asp
  675. Bacillus sp. PK6-026 tRNA-Asp
  676. Bacillus sp. PM43 tRNA-Asp
  677. Bacillus sp. PM8313 tRNA-Asp
  678. Bacillus sp. PS108 tRNA-Asp
  679. Bacillus sp. PS11(2022) tRNA-Asp
  680. Bacillus sp. PS18 tRNA-Asp
  681. Bacillus sp. PS194 tRNA-Asp
  682. Bacillus sp. PS196 tRNA-Asp
  683. Bacillus sp. PS20 tRNA-Asp
  684. Bacillus sp. PS210 tRNA-Asp
  685. Bacillus sp. PS217 tRNA-Asp
  686. Bacillus sp. PS237 tRNA-Asp
  687. Bacillus sp. PS65 tRNA-Asp
  688. Bacillus sp. PS68 tRNA-Asp
  689. Bacillus sp. PS93 tRNA-Asp
  690. Bacillus sp. PS95 tRNA-Asp
  691. Bacillus sp. PsM16 tRNA-Asp
  692. Bacillus sp. PVC-6B tRNA-Asp
  693. Bacillus sp. PW192 tRNA-Asp
  694. Bacillus sp. R45 tRNA-Asp
  695. Bacillus sp. RAR_M1_44 tRNA-Asp
  696. Bacillus sp. Rc4 tRNA-Asp
  697. Bacillus sp. RHF6 tRNA-Asp
  698. Bacillus sp. RHFS10 tRNA-Asp
  699. Bacillus sp. RHFS18 tRNA-Asp
  700. Bacillus sp. RK1064 tRNA-Asp
  701. Bacillus sp. RM3 tRNA-Asp
  702. Bacillus sp. RO3 tRNA-Asp
  703. Bacillus sp. Root920 tRNA-Asp
  704. Bacillus sp. RP12 tRNA-Asp
  705. Bacillus sp. RSS_NA_20 tRNA-Asp
  706. Bacillus sp. Ru63 tRNA-Asp
  707. Bacillus sp. S10C12M tRNA-Asp
  708. Bacillus sp. S17B2 tRNA-Asp
  709. Bacillus sp. S20C3 tRNA-Asp
  710. Bacillus sp. S2(2019) tRNA-Asp
  711. Bacillus sp. S3 tRNA-Asp
  712. Bacillus sp. SA1-12 tRNA-Asp
  713. Bacillus sp. SA116 tRNA-Asp
  714. Bacillus sp. SB49 tRNA-Asp
  715. Bacillus sp. SD088 tRNA-Asp
  716. Bacillus safensis tRNA-Asp
  717. Bacillus sp. SDLI1 tRNA-Asp
  718. Bacillus sp. seq1 tRNA-Asp
  719. Bacillus sp. SG20001 tRNA-Asp
  720. Bacillus sp. SG20032 tRNA-Asp
  721. Bacillus sp. SG20033 tRNA-Asp
  722. Bacillus sp. sid0103 tRNA-Asp
  723. Bacillus sp. SIMBA_005 tRNA-Asp
  724. Bacillus sp. SIMBA_006 tRNA-Asp
  725. Bacillus sp. SIMBA_008 tRNA-Asp
  726. Bacillus sp. SIMBA_026 tRNA-Asp
  727. Bacillus sp. SIMBA_031 tRNA-Asp
  728. Bacillus sp. SIMBA_033 tRNA-Asp
  729. Bacillus sp. SIMBA_154 tRNA-Asp
  730. Bacillus sp. SIMBA_161 tRNA-Asp
  731. Bacillus sp. SJS tRNA-Asp
  732. Bacillus sp. SKDU12 tRNA-Asp
  733. Bacillus salacetis tRNA-Asp
  734. Bacillus sp. SL00103 tRNA-Asp
  735. Bacillus sp. SL112 tRNA-Asp
  736. Bacillus sp. SLBN-46 tRNA-Asp
  737. Bacillus sp. SLBN-57 tRNA-Asp
  738. Bacillus sp. SN1 tRNA-Asp
  739. Bacillus sp. S/N-304-OC-R1 tRNA-Asp
  740. Bacillus sp. SN32 tRNA-Asp
  741. Bacillus sp. SORGH_AS_0510 tRNA-Asp
  742. Bacillus sp. SPARC3 tRNA-Asp
  743. Paenibacillus sp. PL91 tRNA-Asp
  744. Bacillus paralicheniformis tRNA-Asp
  745. Bacillus sp. SW14 tRNA-Asp
  746. Bacillus sp. SYBGC4 tRNA-Asp
  747. Bacillus sp. SYBGCR6 tRNA-Asp
  748. Bacillus sp. SYWMC7 tRNA-Asp
  749. Bacillus sp. SYWMC9 tRNA-Asp
  750. Bacillus sp. SYZHC2 tRNA-Asp
  751. Bacillus sp. SYZHCR11 tRNA-Asp
  752. Bacillus sp. T17B1 tRNA-Asp
  753. Bacillus sp. T2-22 tRNA-Asp
  754. Bacillus sp. T2.9-1 tRNA-Asp(gtc)
  755. Bacillus sp. T9C1 tRNA-Asp
  756. Bacillus sp. TBS-096 tRNA-Asp
  757. Bacillus sp. TE9122W tRNA-Asp
  758. Bacillus sp. TH007 tRNA-Asp
  759. Bacillus sp. TJS119 tRNA-Asp
  760. Bacillus sp. TS-2 tRNA-Asp
  761. Bacillus sp. TSA-4 tRNA-Asp
  762. Bacillus sp. TV3D tRNA-Asp
  763. Bacillus sp. UMB0899 tRNA-Asp
  764. Niallia alba tRNA-Asp
  765. Bacillus sp. URHA0034 tRNA-Asp
  766. Bacillus sp. V26 tRNA-Asp
  767. Bacillus sp. V3B tRNA-Asp
  768. Bacillus sp. V3 tRNA-Asp
  769. Bacillus sp. V59.32a tRNA-Asp
  770. Bacillus sp. WC2502 tRNA-Asp
  771. Bacillus sp. WC2510 tRNA-Asp
  772. Bacillus sp. WMMC1349 tRNA-Asp
  773. Bacillus salipaludis tRNA-Asp
  774. Bacillus sp. WP8 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  775. Bacillus sp. WR11 tRNA-Asp
  776. Bacillus sp. WR12 tRNA-Asp
  777. Bacillus sp. WR13 tRNA-Asp
  778. Bacillus sp. X2(2017) tRNA-Asp
  779. Bacillus sp. XT-2 tRNA-Asp
  780. Bacillus yapensis tRNA-Asp
  781. Bacillus sp. XZ-5 tRNA-Asp
  782. Bacillus sp. y1(2019) tRNA-Asp
  783. Bacillus sp. Y1 tRNA-Asp
  784. Bacillus sp. Y3 tRNA-Asp
  785. Bacillus sp. YAF8 tRNA-Asp
  786. Bacillus sp. YBsi01 tRNA-Asp
  787. Bacillus sp. YBWC18 tRNA-Asp
  788. Bacillus sp. YC2 tRNA-Asp
  789. Bacillus sp. YH3-2-B2 tRNA-Asp
  790. Bacillus sp. YIM B13410 tRNA-Asp
  791. Bacillus sp. YIM B13423 tRNA-Asp
  792. Bacillus sp. YIM B13424 tRNA-Asp
  793. Bacillus sp. YIM B13425 tRNA-Asp
  794. Bacillus sp. YIM B13432 tRNA-Asp
  795. Bacillus sp. YIM B13433 tRNA-Asp
  796. Bacillus sp. YIM B13440 tRNA-Asp
  797. Bacillus sp. YIM B13441 tRNA-Asp
  798. Bacillus sp. YIM B13442 tRNA-Asp
  799. Bacillus sp. YIM B13449 tRNA-Asp
  800. Bacillus sp. YIM B13525 tRNA-Asp
  801. Bacillus sp. YIM B13526 tRNA-Asp
  802. Bacillus sp. YIM B13558 tRNA-Asp
  803. Bacillus sp. YIM B13560 tRNA-Asp
  804. Bacillus sp. YIM B13569 tRNA-Asp
  805. Bacillus sp. YIM B13570 tRNA-Asp
  806. Bacillus sp. YIM B13573 tRNA-Asp
  807. Bacillus sp. YIM B13574 tRNA-Asp
  808. Bacillus sp. YIM B13582 tRNA-Asp
  809. Bacillus sp. YIM B13584 tRNA-Asp
  810. Bacillus sp. YIM B13585 tRNA-Asp
  811. Bacillus sp. YIM B13589 tRNA-Asp
  812. Bacillus sp. YIM B13590 tRNA-Asp
  813. Bacillus sp. YIM B13597 tRNA-Asp
  814. Bacillus sp. YIM B13600 tRNA-Asp
  815. Bacillus sp. YIM B13601 tRNA-Asp
  816. Bacillus sp. YIM B13602 tRNA-Asp
  817. Bacillus sp. YIM B13603 tRNA-Asp
  818. Bacillus sp. YIM B13604 tRNA-Asp
  819. Bacillus sp. YIM B13606 tRNA-Asp
  820. Bacillus sp. YIM B13607 tRNA-Asp
  821. Bacillus sp. YIM B13608 tRNA-Asp
  822. Bacillus sp. YIM B13609 tRNA-Asp
  823. Bacillus sp. YIM B13610 tRNA-Asp
  824. Bacillus sp. YKCMOAS1 tRNA-Asp
  825. Neobacillus piezotolerans tRNA-Asp
  826. Bacillus sp. YP1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  827. Bacillus sp. z60-10 tRNA-Asp
  828. Bacillus sp. z60-11 tRNA-Asp
  829. Bacillus sp. z60-18 tRNA-Asp
  830. Bacillus sp. ZCB01 tRNA-Asp
  831. Bacillus sp. ZHX3 tRNA-Asp
  832. Bacillus sp. ZY-1-1 tRNA-Asp
  833. Bacillus sp. ZZV12-4809 tRNA-Asp
  834. Bacillus stercoris tRNA-Asp
  835. Bacillus stratosphericus tRNA-Asp
  836. Bacillus subtilis BEST7003 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  837. Bacillus subtilis BEST7613 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  838. Bacillus subtilis BSn5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  839. Bacillus subtilis E1 tRNA-Asp-GTC
  840. Bacillus subtilis HJ5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  841. Bacillus subtilis J22 tRNA-Asp
  842. Bacillus subtilis J23 tRNA-Asp
  843. Bacillus subtilis J24 tRNA-Asp
  844. Bacillus subtilis J25 tRNA-Asp
  845. Bacillus subtilis J26 tRNA-Asp
  846. Bacillus subtilis J27 tRNA-Asp
  847. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  848. Bacillus subtilis MB73/2 tRNA-Asp
  849. Bacillus subtilis PY79 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  850. Bacillus subtilis QB928 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  851. Bacillus subtilis QH-1 tRNA-Asp
  852. Bacillus subtilis subsp. globigii tRNA-Asp
  853. Bacillus inaquosorum KCTC 13429 tRNA-Asp
  854. Bacillus subtilis subsp. natto BEST195 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  855. Bacillus subtilis subsp. natto tRNA-Asp
  856. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  857. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Asp
  858. Bacillus subtilis subsp. subtilis str. 168 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  859. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  860. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  861. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  862. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  863. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  864. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  865. Bacillus subtilis subsp. subtilis str. SC-8 tRNA-Asp
  866. Bacillus subtilis subsp. subtilis str. SMY tRNA-Asp
  867. Bacillus subtilis subsp. subtilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  868. Bacillus subtilis TO-A tRNA-Asp
  869. Bacillus subtilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  870. Bacillus subtilis XF-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  871. Bacillus swezeyi tRNA-Asp
  872. Bacillus tequilensis tRNA-Asp(gtc)
  873. Bacillus thuringiensis tRNA-Asp
  874. Sutcliffiella tianshenii tRNA-Asp
  875. Alkalihalobacillus trypoxylicola tRNA-Asp
  876. Bacillus vallismortis tRNA-Asp
  877. Bacillus velezensis AS43.3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  878. Bacillus velezensis CAU B946 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  879. Bacillus velezensis FZB42 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  880. Bacillus velezensis M27 tRNA-Asp
  881. Bacillus velezensis NAU-B3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  882. Bacillus velezensis NJN-6 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  883. Bacillus velezensis SQR9 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  884. Bacillus velezensis TrigoCor1448 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  885. Bacillus velezensis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  886. Bacillus velezensis UCMB5033 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  887. Bacillus velezensis UCMB5036 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  888. Bacillus velezensis UCMB5113 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  889. Bacillus velezensis YAU B9601-Y2 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  890. Rossellomorea vietnamensis tRNA-Asp
  891. Neobacillus vireti LMG 21834 tRNA-Asp
  892. Metabacillus harenarius tRNA-Asp
  893. Bacillus wiedmannii tRNA-Asp
  894. Pseudobacillus wudalianchiensis tRNA-Asp
  895. Bacillus xiamenensis tRNA-Asp
  896. Bacillus xiapuensis tRNA-Asp
  897. Bacillus zhangzhouensis tRNA-Asp
  898. bacterium 1XD42-44 tRNA-Asp
  899. bacterium LRH843 tRNA-Asp
  900. Bacteroidia bacterium tRNA-Asp
  901. Bifidobacterium thermophilum tRNA-Asp
  902. Candidatus Avamphibacillus intestinigallinarum (gut metagenome) tRNA-Asp
  903. Cerasibacillus quisquiliarum tRNA-Asp
  904. Cerasibacillus terrae tRNA-Asp
  905. Cerasibacillus sp. JNUCC 74 tRNA-Asp
  906. Cerasibacillus sp. tRNA-Asp
  907. Clostridium sp. 1xD42-85 tRNA-Asp
  908. Compostibacillus humi tRNA-Asp
  909. Cutibacterium acnes tRNA-Asp
  910. Cytobacillus citreus tRNA-Asp
  911. Cytobacillus eiseniae tRNA-Asp
  912. Cytobacillus firmus tRNA-Asp
  913. Cytobacillus gottheilii tRNA-Asp
  914. Cytobacillus horneckiae tRNA-Asp
  915. Cytobacillus kochii tRNA-Asp
  916. Cytobacillus mangrovibacter tRNA-Asp
  917. Cytobacillus oceanisediminis tRNA-Asp(gtc)
  918. Cytobacillus praedii tRNA-Asp
  919. Cytobacillus pseudoceanisediminis tRNA-Asp(gtc)
  920. Cytobacillus purgationiresistens tRNA-Asp
  921. Cytobacillus solani tRNA-Asp
  922. Cytobacillus sp. ABV4_503 tRNA-Asp
  923. Cytobacillus sp. AMY 15.2 tRNA-Asp
  924. Cytobacillus sp. BC1816 tRNA-Asp
  925. Cytobacillus sp. C11.1 tRNA-Asp
  926. Cytobacillus sp. EB106-05-05-XG126 tRNA-Asp
  927. Cytobacillus sp. FSL H8-0458 tRNA-Asp
  928. Cytobacillus sp. FSL K6-0129 tRNA-Asp
  929. Cytobacillus sp. FSL K6-0265 tRNA-Asp
  930. Cytobacillus sp. FSL M8-0252 tRNA-Asp
  931. Cytobacillus sp. FSL R5-0377 tRNA-Asp
  932. Cytobacillus sp. FSL R5-0569 tRNA-Asp
  933. Cytobacillus sp. FSL R5-0596 tRNA-Asp
  934. Cytobacillus sp. FSL R7-0680 tRNA-Asp
  935. Cytobacillus sp. FSL R7-0696 tRNA-Asp
  936. Cytobacillus sp. FSL W7-1323 tRNA-Asp
  937. Cytobacillus sp. FSL W8-0315 tRNA-Asp
  938. Cytobacillus sp. Hz8 tRNA-Asp
  939. Cytobacillus sp. NJ13 tRNA-Asp
  940. Cytobacillus spongiae tRNA-Asp
  941. Cytobacillus sp. OWB-43 tRNA-Asp
  942. Cytobacillus sp. QJM3NY_8 tRNA-Asp
  943. Cytobacillus stercorigallinarum tRNA-Asp
  944. Cytobacillus sp. SAFR-174 tRNA-Asp
  945. Cytophagales bacterium tRNA-Asp
  946. Desertibacillus haloalkaliphilus tRNA-Asp
  947. Desulfobacterales bacterium tRNA-Asp
  948. Desulfosarcina sp. tRNA-Asp
  949. Domibacillus aminovorans tRNA-Asp
  950. Domibacillus antri tRNA-Asp
  951. Domibacillus enclensis tRNA-Asp
  952. Domibacillus epiphyticus tRNA-Asp
  953. Domibacillus indicus tRNA-Asp
  954. Domibacillus iocasae tRNA-Asp
  955. Domibacillus mangrovi tRNA-Asp
  956. Domibacillus sp. 8LH tRNA-Asp
  957. Domibacillus sp. A3M-37 tRNA-Asp
  958. Domibacillus sp. DTU_2020_1001157_1_SI_ALB_TIR_016 tRNA-Asp
  959. Domibacillus sp. PGB-M46 tRNA-Asp
  960. Domibacillus tundrae tRNA-Asp
  961. Embleya sp. NPDC056575 tRNA-Asp
  962. Embleya sp. NPDC059237 tRNA-Asp
  963. Enterococcus faecalis tRNA-Asp
  964. Escherichia coli tRNA-Asp
  965. Falsibacillus albus tRNA-Asp
  966. Filobacillus milosensis tRNA-Asp
  967. Gracilibacillus alcaliphilus tRNA-Asp
  968. Gracilibacillus boraciitolerans tRNA-Asp
  969. Gracilibacillus dipsosauri tRNA-Asp
  970. Gracilibacillus halophilus YIM-C55.5 tRNA-Asp
  971. Gracilibacillus halotolerans tRNA-Asp
  972. Gracilibacillus marinus tRNA-Asp
  973. Gracilibacillus orientalis tRNA_Asp_GTC
  974. Gracilibacillus pellucidus tRNA-Asp
  975. Gracilibacillus sp. D59 tRNA-Asp
  976. Gracilibacillus sp. HCP3S3_G5_1 tRNA-Asp
  977. Gracilibacillus sp. HCP3S3_G5_2 tRNA-Asp
  978. Gracilibacillus sp. JCM 18860 tRNA-Asp
  979. Gracilibacillus sp. JCM 18966 tRNA-Asp
  980. Gracilibacillus salitolerans tRNA-Asp
  981. Gracilibacillus salinarum tRNA-Asp
  982. Gracilibacillus caseinilyticus tRNA-Asp
  983. Gracilibacillus oryzae tRNA-Asp
  984. Gracilibacillus thailandensis tRNA-Asp
  985. Gracilibacillus ureilyticus tRNA_Asp_GTC
  986. Gracilibacillus xinjiangensis tRNA-Asp
  987. Halalkalibacillus sediminis tRNA-Asp
  988. Halalkalibacter akibai tRNA-Asp
  989. Halalkalibacter alkaliphilus tRNA-Asp
  990. Halalkalibacter alkalisediminis tRNA-Asp
  991. Halalkalibacterium halodurans C-125 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  992. Halalkalibacterium halodurans tRNA-Asp
  993. Halalkalibacterium ligniniphilum tRNA
  994. Halalkalibacter kiskunsagensis tRNA-Asp
  995. Halalkalibacter oceani tRNA-Asp
  996. Halalkalibacter sp. AB-rgal2 tRNA-Asp
  997. Halalkalibacter sp. APA_J-10(15) tRNA-Asp
  998. Halalkalibacter sp. HAAS-P013 tRNA-Asp
  999. Halalkalibacter sp. HAAS-P014 tRNA-Asp
  1000. Halalkalibacter suaedae tRNA-Asp
  1001. Halalkalibacter wakoensis tRNA-Asp
  1002. Halobacillaceae bacterium ABV2_076 tRNA-Asp
  1003. Halobacillus andaensis tRNA-Asp
  1004. Halobacillus campisalis tRNA-Asp
  1005. Halobacillus dabanensis tRNA_Asp_GTC
  1006. Halobacillus faecis tRNA-Asp
  1007. Halobacillus halophilus DSM 2266 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  1008. Halobacillus halophilus tRNA-Asp
  1009. Halobacillus karajensis tRNA-Asp
  1010. Halobacillus kuroshimensis tRNA-Asp
  1011. Halobacillus litoralis tRNA-Asp
  1012. Halobacillus locisalis tRNA-Asp
  1013. Halobacillus mangrovi tRNA-Asp
  1014. Halobacillus naozhouensis tRNA-Asp
  1015. Halobacillus salinus tRNA-Asp
  1016. Halobacillus seohaensis tRNA-Asp
  1017. Halobacillus sp. A1-3 tRNA-Asp
  1018. Halobacillus sp. A1 tRNA-Asp
  1019. Halobacillus sp. A5 tRNA-Asp
  1020. Halobacillus sp. ABA4_118 tRNA-Asp
  1021. Halobacillus sp. ABD4_316 tRNA-Asp
  1022. Halobacillus sp. ABH2_015 tRNA-Asp
  1023. Halobacillus sp. ABR2_026 tRNA-Asp
  1024. Halobacillus sp. ACCC02827 tRNA-Asp
  1025. Halobacillus sp. AWH4_228 tRNA-Asp
  1026. Halobacillus sp. AWM4_238 tRNA-Asp
  1027. Halobacillus sp. B23F22_1 tRNA-Asp
  1028. Halobacillus sp. B23F22_5 tRNA-Asp
  1029. Halobacillus sp. B29 tRNA-Asp
  1030. Halobacillus sp. BBL2006 tRNA-Asp
  1031. Halobacillus sp. GSS1 tRNA-Asp
  1032. Halobacillus sp. H74 tRNA-Asp
  1033. Halobacillus sp. HZG1 tRNA-Asp
  1034. Halobacillus sp. K22 tRNA-Asp
  1035. Halobacillus yeomjeoni tRNA-Asp
  1036. Halobacillus sp. MO56 tRNA-Asp
  1037. Halobacillus sp. Nhm2S1 tRNA-Asp
  1038. Halobacillus fulvus tRNA-Asp
  1039. Halobacillus salinarum tRNA-Asp
  1040. Halobacillus amylolyticus tRNA-Asp
  1041. Halobacillus shinanisalinarum tRNA-Asp
  1042. Halobacillus sp. SY10 tRNA-Asp
  1043. Halobacillus sp. tRNA-Asp
  1044. Halobacillus trueperi tRNA-Asp
  1045. Halobacillus yeomjeoni tRNA-Asp
  1046. Halolactibacillus alkaliphilus tRNA_Asp_GTC
  1047. Halolactibacillus halophilus tRNA-Asp
  1048. Halolactibacillus miurensis tRNA-Asp
  1049. Halomonas sp. MG34 tRNA-Asp
  1050. Helicobacter pylori tRNA-Asp
  1051. Heyndrickxia oleronia tRNA-Asp
  1052. Heyndrickxia sp. FSL K6-6286 tRNA-Asp
  1053. Heyndrickxia sp. FSL W8-0496 tRNA-Asp
  1054. Heyndrickxia sp. FW510-T9 tRNA-Asp
  1055. Heyndrickxia sp. NPDC080065 tRNA-Asp
  1056. Heyndrickxia sporothermodurans tRNA-Asp
  1057. Kitasatospora purpeofusca tRNA-Asp
  1058. Kitasatospora sp. NPDC056181 tRNA-Asp
  1059. Kitasatospora sp. NPDC057595 tRNA-Asp
  1060. Kitasatospora sp. NPDC057692 tRNA-Asp
  1061. Kitasatospora sp. NPDC058218 tRNA-Asp
  1062. Klebsiella pneumoniae tRNA-Asp
  1063. Lederbergia citri tRNA-Asp
  1064. Lederbergia galactosidilytica tRNA-Asp
  1065. Lederbergia graminis tRNA-Asp
  1066. Lederbergia panacisoli tRNA-Asp
  1067. Lederbergia ruris tRNA-Asp
  1068. Lederbergia sp. NSJ-179 tRNA-Asp
  1069. Lentibacillus amyloliquefaciens tRNA-Asp
  1070. Lentibacillus halodurans tRNA_Asp_GTC
  1071. Lentibacillus halophilus tRNA-Asp
  1072. Lentibacillus juripiscarius tRNA-Asp
  1073. Lentibacillus salicampi tRNA-Asp
  1074. Lentibacillus salinarum tRNA-Asp
  1075. Lentibacillus sp. CBA3610 tRNA-Asp
  1076. Lentibacillus sp. JNUCC-1 tRNA-Asp
  1077. Lentibacillus cibarius tRNA-Asp
  1078. Lentibacillus cibarius tRNA-Asp
  1079. Lentibacillus lipolyticus tRNA-Asp
  1080. Lentibacillus sp. tRNA-Asp
  1081. Lysinibacillus sphaericus tRNA-Asp
  1082. Mangrovibacillus sp. Mu-81 tRNA-Asp
  1083. Membranihabitans marinus tRNA-Asp
  1084. Mesobacillus foraminis tRNA-Asp
  1085. Mesobacillus maritimus tRNA-Asp
  1086. Metabacillus bambusae tRNA-Asp
  1087. Metabacillus crassostreae tRNA-Asp
  1088. Metabacillus endolithicus tRNA-Asp
  1089. Metabacillus halosaccharovorans tRNA-Asp
  1090. Metabacillus herbersteinensis tRNA-Asp
  1091. Metabacillus kandeliae tRNA-Asp
  1092. Metabacillus litoralis tRNA-Asp
  1093. Metabacillus malikii tRNA-Asp
  1094. Metabacillus mangrovi tRNA-Asp
  1095. Metabacillus niabensis tRNA-Asp
  1096. Metabacillus rhizolycopersici tRNA-Asp
  1097. Metabacillus sp. 113a tRNA-Asp
  1098. Metabacillus sp. 22489 tRNA-Asp
  1099. Metabacillus sp. 84 tRNA-Asp
  1100. Metabacillus sp. B2-18 tRNA-Asp
  1101. Metabacillus sediminis Metabacillus sp. FJAT-52054 tRNA-Asp
  1102. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Asp
  1103. Metabacillus harenarius Metabacillus sp. HB246100 tRNA-Asp
  1104. Metabacillus sp. Hm71 tRNA-Asp
  1105. Metabacillus flavus tRNA-Asp
  1106. Metabacillus sp. KJ11-3 tRNA-Asp
  1107. Metabacillus elymi tRNA-Asp
  1108. Chryseobacillus diguaensis Metabacillus sp. RGM 3146 tRNA-Asp
  1109. Metabacillus sp. tRNA-Asp
  1110. Metabacillus sp. YM-086 tRNA-Asp
  1111. Micromonospora aridisoli tRNA-Asp
  1112. Micromonospora profundi tRNA-Asp
  1113. Micromonospora sp. 1209 tRNA-Asp
  1114. Mycobacteroides abscessus subsp. abscessus tRNA-Asp(gtc)
  1115. Mycobacteroides abscessus subsp. massiliense tRNA-Asp(gtc)
  1116. Natronobacillus azotifigens tRNA-Asp
  1117. Negativibacillus sp. 1xD8-3 tRNA-Asp
  1118. Neobacillus bataviensis tRNA-Asp
  1119. Neobacillus canaveralius tRNA-Asp
  1120. Neobacillus cucumis tRNA-Asp
  1121. Neobacillus drentensis tRNA-Asp
  1122. Neobacillus driksii tRNA-Asp
  1123. Neobacillus ginsengisoli tRNA-Asp
  1124. Neobacillus niacini tRNA-Asp
  1125. Neobacillus novalis tRNA-Asp
  1126. Neobacillus phoenicis tRNA-Asp
  1127. Neobacillus pocheonensis tRNA-Asp
  1128. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Asp
  1129. Neobacillus sp. 19 tRNA-Asp
  1130. Neobacillus sp. 211 tRNA-Asp
  1131. Neobacillus sp. B4I6 tRNA-Asp
  1132. Neobacillus sp. BF23-41 tRNA-Asp
  1133. Neobacillus sp. C211 tRNA-Asp
  1134. Neobacillus sp. CF12 tRNA-Asp
  1135. Neobacillus sp. D3-1R tRNA-Asp
  1136. Neobacillus sp. DFD-2R tRNA-Asp
  1137. Neobacillus sp. DHD-1R tRNA-Asp
  1138. Neobacillus sp. DY30 tRNA-Asp
  1139. Neobacillus sp. Fa239 tRNA-Asp
  1140. Neobacillus sp. FSL H8-0543 tRNA-Asp
  1141. Neobacillus sp. GCM10027624 tRNA-Asp
  1142. Neobacillus rhizosphaerae tRNA-Asp
  1143. Neobacillus sp. K501 tRNA-Asp
  1144. Neobacillus sp. KR4-4 tRNA-Asp
  1145. Neobacillus terrisolis Neobacillus sp. LXY-4 tRNA-Asp
  1146. Neobacillus sp. M.A.Huq-85 tRNA-Asp
  1147. Neobacillus sp. MER 74 tRNA-Asp
  1148. Neobacillus sp. MM2021_6 tRNA-Asp
  1149. Neobacillus sp. NPDC058068 tRNA-Asp
  1150. Neobacillus sp. NPDC093127 tRNA-Asp
  1151. Neobacillus sp. NPDC093182 tRNA-Asp
  1152. Neobacillus sp. NPDC097160 tRNA-Asp
  1153. Neobacillus sp. OS1-2 tRNA-Asp
  1154. Neobacillus nitrireducens tRNA-Asp
  1155. Neobacillus sp. PS2-9 tRNA-Asp
  1156. Neobacillus sp. PS3-40 tRNA-Asp
  1157. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Asp
  1158. Neobacillus sp. SuZ13 tRNA-Asp
  1159. Neobacillus sp. tRNA-Asp
  1160. Neobacillus sp. WH10 tRNA-Asp
  1161. Neobacillus sp. YX16 tRNA-Asp
  1162. Neobacillus vireti tRNA-Asp
  1163. Niallia hominis tRNA-Asp
  1164. Niallia laureatilytica tRNA-Asp
  1165. Niallia oryzisoli tRNA-Asp
  1166. Niallia sp. 01092 tRNA-Asp
  1167. Niallia sp. FSL K6-0077 tRNA-Asp
  1168. Niallia sp. FSL K6-0212 tRNA-Asp
  1169. Niallia sp. FSL M8-0099 tRNA-Asp
  1170. Niallia sp. FSL R7-0271 tRNA-Asp
  1171. Niallia sp. FSL R7-0648 tRNA-Asp
  1172. Niallia sp. FSL W8-0177 tRNA-Asp
  1173. Niallia sp. FSL W8-0635 tRNA-Asp
  1174. Niallia sp. FSL W8-0951 tRNA-Asp
  1175. Niallia sp. FSL W8-0954 tRNA-Asp
  1176. Niallia sp. FSL W8-1348 tRNA-Asp
  1177. Niallia sp. HCP3S3_B10 tRNA-Asp
  1178. Niallia tiangongensis Niallia sp. JL1B1071 tRNA-Asp
  1179. Niallia sp. Kr1 Niallia sp. Krafla_26 tRNA-Asp
  1180. Niallia sp. Man26 tRNA-Asp
  1181. Niallia sp. MER 6 tRNA-Asp
  1182. Niallia sp. MER TA 168 tRNA-Asp
  1183. Niallia sp. NCCP-28 tRNA-Asp
  1184. Niallia sp. RD1 tRNA-Asp
  1185. Niallia sp. Sow4_A1 tRNA-Asp
  1186. Niallia sp. SS-2023 tRNA-Asp
  1187. Niallia sp. tRNA-Asp
  1188. Niallia sp. XMNu-256 tRNA-Asp
  1189. Niallia taxi tRNA-Asp
  1190. Nocardiopsis dassonvillei tRNA-Asp
  1191. Oceanobacillus aidingensis tRNA-Asp
  1192. Oceanobacillus alkalisoli tRNA-Asp
  1193. Oceanobacillus arenosus tRNA-Asp
  1194. Oceanobacillus bengalensis tRNA-Asp
  1195. Oceanobacillus caeni tRNA-Asp
  1196. Oceanobacillus chungangensis tRNA-Asp
  1197. Oceanobacillus halophilus tRNA-Asp
  1198. Oceanobacillus iheyensis HTE831 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1199. Oceanobacillus iheyensis tRNA-Asp
  1200. Oceanobacillus indicireducens tRNA-Asp
  1201. Oceanobacillus jeddahensis tRNA-Asp
  1202. Oceanobacillus jordanicus tRNA-Asp
  1203. Oceanobacillus kapialis tRNA-Asp
  1204. Oceanobacillus kimchii tRNA-Asp
  1205. Oceanobacillus locisalsi tRNA-Asp
  1206. Oceanobacillus longus tRNA-Asp
  1207. Oceanobacillus luteolus tRNA-Asp
  1208. Oceanobacillus neutriphilus tRNA-Asp
  1209. Oceanobacillus oncorhynchi subsp. incaldanensis tRNA-Asp
  1210. Oceanobacillus oncorhynchi subsp. oncorhynchi tRNA-Asp
  1211. Oceanobacillus oncorhynchi tRNA-Asp
  1212. Oceanobacillus phoenicis tRNA-Asp
  1213. Oceanobacillus picturae tRNA-Asp
  1214. Oceanobacillus polygoni tRNA-Asp
  1215. Oceanobacillus profundus tRNA-Asp
  1216. Oceanobacillus sojae tRNA-Asp
  1217. Oceanobacillus sp. 143 tRNA-Asp
  1218. Oceanobacillus zhaokaii tRNA-Asp
  1219. Oceanobacillus sp. CAU 1775 tRNA-Asp
  1220. Oceanobacillus sp. CF4.6 tRNA-Asp
  1221. Oceanobacillus sp. E9 tRNA-Asp
  1222. Oceanobacillus sp. FSL H7-0719 tRNA-Asp
  1223. Oceanobacillus sp. FSL K6-0118 tRNA-Asp
  1224. Oceanobacillus sp. FSL K6-0127 tRNA-Asp
  1225. Oceanobacillus sp. FSL K6-0251 tRNA-Asp
  1226. Oceanobacillus sp. FSL K6-2867 tRNA-Asp
  1227. Oceanobacillus sp. FSL K6-3682 tRNA-Asp
  1228. Oceanobacillus sp. FSL W7-1281 tRNA-Asp
  1229. Oceanobacillus sp. FSL W7-1293 tRNA-Asp
  1230. Oceanobacillus sp. FSL W7-1304 tRNA-Asp
  1231. Oceanobacillus sp. FSL W7-1309 tRNA-Asp
  1232. Oceanobacillus sp. FSL W8-0428 tRNA-Asp
  1233. Oceanobacillus sp. HCA-5259 tRNA-Asp
  1234. Oceanobacillus sp. ISL-73 tRNA-Asp
  1235. Oceanobacillus sp. ISL-74 tRNA-Asp
  1236. Oceanobacillus sp. J11TS1 tRNA-Asp
  1237. Oceanobacillus sp. M60 tRNA-Asp
  1238. Oceanobacillus sp. M65 tRNA-Asp
  1239. Oceanobacillus sp. MO10714A tRNA-Asp
  1240. Oceanobacillus sp. SE10311 tRNA-Asp
  1241. Oceanobacillus piezotolerans tRNA-Asp
  1242. Oerskovia enterophila tRNA-Asp
  1243. Ornithinibacillus bavariensis tRNA-Asp
  1244. Ornithinibacillus caprae tRNA-Asp
  1245. Ornithinibacillus halotolerans tRNA-Asp
  1246. Ornithinibacillus hominis tRNA-Asp
  1247. Ornithinibacillus massiliensis tRNA-Asp
  1248. Ornithinibacillus salinisoli tRNA-Asp
  1249. Ornithinibacillus xuwenensis Ornithinibacillus sp. 16A2E tRNA-Asp
  1250. Ornithinibacillus jepli Ornithinibacillus sp. 179-J 7C1 HS tRNA-Asp
  1251. Ornithinibacillus liuyingii Ornithinibacillus sp. 27F3 tRNA-Asp
  1252. Ornithinibacillus sp. FSL M8-0202 tRNA-Asp
  1253. Ornithinibacillus proteolyticus Ornithinibacillus sp. JPR2-1 tRNA-Asp
  1254. Ornithinibacillus sp. tRNA-Asp
  1255. Paenibacillus alvei tRNA-Asp
  1256. Paenibacillus sp. 7884-2 tRNA-Asp
  1257. Paenibacillus sp. FSL R5-0490 tRNA-Asp
  1258. Paenibacillus sp. NRS-1760 tRNA-Asp
  1259. Pallidibacillus pasinlerensis tRNA-Asp
  1260. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Asp
  1261. Pallidibacillus thermolactis tRNA-Asp
  1262. Paracoccus sp. DMF tRNA-Asp
  1263. Paraliobacillus quinghaiensis tRNA-Asp
  1264. Paraliobacillus ryukyuensis tRNA-Asp
  1265. Paraliobacillus sp. JSM ZJ581 tRNA-Asp
  1266. Paraliobacillus sp. PM-2 tRNA-Asp
  1267. Peribacillus asahii tRNA-Asp
  1268. Peribacillus cavernae tRNA-Asp
  1269. Peribacillus psychrosaccharolyticus tRNA-Asp
  1270. Peribacillus sp. BM1 tRNA-Asp
  1271. Peribacillus sp. FSL H8-0477 tRNA-Asp
  1272. Peribacillus sp. Hz7 tRNA-Asp
  1273. Peribacillus sp. JNUCC 23 tRNA-Asp
  1274. Peribacillus sp. NPDC096379 tRNA-Asp
  1275. Perspicuibacillus lycopersici tRNA-Asp
  1276. Piscibacillus salipiscarius tRNA-Asp
  1277. Piscibacillus sp. B03 tRNA-Asp
  1278. Planococcus maritimus tRNA-Asp
  1279. Planococcus sp. SIMBA_143 tRNA-Asp
  1280. Pontibacillus chungwhensis BH030062 tRNA-Asp
  1281. Pontibacillus chungwhensis tRNA-Asp
  1282. Pontibacillus halophilus JSM 076056 = DSM 19796 tRNA-Asp
  1283. Pontibacillus litoralis JSM 072002 tRNA-Asp
  1284. Pontibacillus marinus BH030004 = DSM 16465 tRNA-Asp
  1285. Pontibacillus salicampi tRNA-Asp
  1286. Pontibacillus salipaludis tRNA-Asp
  1287. Pontibacillus sp. ABV4_188 tRNA-Asp
  1288. Pontibacillus sp. ALD_SL1 tRNA-Asp
  1289. Pontibacillus sp. HMF3514 tRNA-Asp
  1290. Pontibacillus sp. HN14 tRNA-Asp
  1291. Pontibacillus yanchengensis tRNA-Asp
  1292. Pontibacillus yanchengensis Y32 tRNA-Asp
  1293. Pradoshia sp. D12 tRNA-Asp
  1294. Pradoshia sp. tRNA-Asp
  1295. Priestia sp. WB3 tRNA-Asp
  1296. Pseudobacillus badius tRNA-Asp
  1297. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Asp
  1298. Pseudobacillus sp. FSL P4-0506 tRNA-Asp
  1299. Pseudobacillus sp. tRNA-Asp
  1300. Pseudomonas aeruginosa tRNA-Asp
  1301. Bacillus subtilis A29 tRNA-Asp
  1302. Pseudomonas sp. ISL-84 tRNA-Asp
  1303. Pseudomonas sp. ISL-88 tRNA-Asp
  1304. Pseudoneobacillus rhizosphaerae tRNA-Asp
  1305. Pseudoneobacillus sp. tRNA-Asp
  1306. Psychrobacillus sp. MER TA 17 tRNA-Asp
  1307. Radiobacillus kanasensis tRNA-Asp
  1308. Ralstonia pickettii tRNA-Asp
  1309. Rhizobium ruizarguesonis tRNA-Asp
  1310. Rhodococcus qingshengii tRNA-Asp
  1311. Rhodococcus zopfii tRNA-Asp
  1312. Anoxybacillus andreesenii tRNA-Asp
  1313. Robertmurraya crescens tRNA-Asp
  1314. Robertmurraya massiliosenegalensis tRNA-Asp
  1315. Robertmurraya phoenicis tRNA-Asp
  1316. Robertmurraya siralis tRNA-Asp
  1317. Robertmurraya sp. DFI.2.37 tRNA-Asp
  1318. Robertmurraya sp. FSL W8-0741 tRNA-Asp
  1319. Roseburia sp. 1XD42-34 tRNA-Asp
  1320. Rossellomorea aquimaris tRNA-Asp
  1321. Rossellomorea arthrocnemi tRNA-Asp
  1322. Rossellomorea orangium tRNA-Asp
  1323. Rossellomorea oryzaecorticis tRNA-Asp
  1324. Rossellomorea pakistanensis tRNA-Asp
  1325. Rossellomorea sedimentorum tRNA-Asp
  1326. Rossellomorea sp. ABR4_004 tRNA-Asp
  1327. Rossellomorea sp. ABR4_012 tRNA-Asp
  1328. Rossellomorea sp. AcN35-11 tRNA-Asp
  1329. Rossellomorea sp. BNER tRNA-Asp
  1330. Rossellomorea sp. DA94 tRNA-Asp
  1331. Rossellomorea sp. DUT-2 tRNA-Asp
  1332. Rossellomorea sp. FS2 tRNA-Asp
  1333. Rossellomorea sp. GCM10028870 tRNA-Asp
  1334. Rossellomorea sp. H39__3 tRNA-Asp
  1335. Rossellomorea sp. KS-H15a tRNA-Asp
  1336. Rossellomorea sp. LJF3 tRNA-Asp
  1337. Rossellomorea sp. LjRoot5 tRNA-Asp
  1338. Rossellomorea sp. NPDC071047 tRNA-Asp
  1339. Rossellomorea sp. NPDC077527 tRNA-Asp
  1340. Rossellomorea sp. NRS-1567 tRNA-Asp
  1341. Rossellomorea sp. NS-SX7 tRNA-Asp
  1342. Rossellomorea sp. QJM3NY_18 tRNA-Asp
  1343. Rossellomorea sp. y25 tRNA-Asp
  1344. Rossellomorea sp. YZS02 tRNA-Asp
  1345. Rossellomorea yichunensis tRNA-Asp
  1346. Salimicrobium album tRNA_Asp_GTC
  1347. Salimicrobium halophilum tRNA_Asp_GTC
  1348. Salimicrobium jeotgali tRNA-Asp
  1349. Salimicrobium sp. PL1-032A tRNA-Asp
  1350. Salimicrobium humidisoli tRNA-Asp
  1351. Salinibacillus xinjiangensis tRNA-Asp
  1352. Salirhabdus euzebyi tRNA-Asp
  1353. Salirhabdus salicampi tRNA-Asp
  1354. Sediminibacillus dalangtanensis tRNA-Asp
  1355. Shouchella clausii KSM-K16 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1356. Shouchella clausii tRNA-Asp
  1357. Shouchella hunanensis tRNA-Asp
  1358. Shouchella lehensis G1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1359. Shouchella miscanthi tRNA-Asp
  1360. Shouchella phoenicis tRNA-Asp
  1361. Shouchella rhizosphaerae tRNA-Asp
  1362. Shouchella phoenicis Shouchella sp. 1P09AA tRNA-Asp
  1363. Shouchella sp. JSM 1781072 tRNA-Asp
  1364. Shouchella xiaoxiensis tRNA-Asp
  1365. Sinobaca qinghaiensis tRNA-Asp
  1366. soil metagenome tRNA
  1367. Bacillus velezensis A3 tRNA-Asp
  1368. Sporosarcina globispora tRNA-Asp
  1369. Staphylococcus aureus tRNA-Asp
  1370. Staphylococcus pseudintermedius tRNA-Asp
  1371. Streptococcus pneumoniae tRNA-Asp(gtc)
  1372. Streptomyces afghaniensis tRNA-Asp(gtc)
  1373. Streptomyces albidoflavus tRNA-Asp
  1374. Streptomyces celluloflavus tRNA-Asp
  1375. Streptomyces chartreusis tRNA-Asp
  1376. Streptomyces cyaneofuscatus tRNA-Asp
  1377. Streptomyces diastaticus tRNA-Asp
  1378. Streptomyces erythrochromogenes tRNA-Asp
  1379. Streptomyces eurythermus tRNA-Asp
  1380. Streptomyces griseus Streptomyces fimicarius tRNA-Asp
  1381. Streptomyces fungicidicus tRNA-Asp
  1382. Streptomyces massasporeus tRNA-Asp
  1383. Streptomyces mirabilis tRNA-Asp
  1384. Streptomyces olivaceus tRNA-Asp
  1385. Streptomyces parvus tRNA-Asp
  1386. Streptomyces rubiginosohelvolus tRNA-Asp
  1387. Streptomyces scopuliridis tRNA-Asp
  1388. Streptomyces sp. NPDC055632 tRNA-Asp
  1389. Streptomyces sp. NPDC055961 tRNA-Asp
  1390. Streptomyces sp. NPDC056441 tRNA-Asp
  1391. Streptomyces sp. NPDC056465 tRNA-Asp
  1392. Streptomyces sp. NPDC056470 tRNA-Asp
  1393. Streptomyces sp. NPDC056544 tRNA-Asp
  1394. Streptomyces sp. NPDC056637 tRNA-Asp
  1395. Streptomyces sp. NPDC056701 tRNA-Asp
  1396. Streptomyces sp. NPDC056708 tRNA-Asp
  1397. Streptomyces sp. NPDC056716 tRNA-Asp
  1398. Streptomyces sp. NPDC056734 tRNA-Asp
  1399. Streptomyces sp. NPDC056756 tRNA-Asp
  1400. Streptomyces sp. NPDC056820 tRNA-Asp
  1401. Streptomyces sp. NPDC056821 tRNA-Asp
  1402. Streptomyces sp. NPDC056831 tRNA-Asp
  1403. Streptomyces sp. NPDC056883 tRNA-Asp
  1404. Streptomyces sp. NPDC056910 tRNA-Asp
  1405. Streptomyces sp. NPDC057011 tRNA-Asp
  1406. Streptomyces sp. NPDC057592 tRNA-Asp
  1407. Streptomyces sp. NPDC057651 tRNA-Asp
  1408. Streptomyces sp. NPDC057680 tRNA-Asp
  1409. Streptomyces sp. NPDC057695 tRNA-Asp
  1410. Streptomyces sp. NPDC057696 tRNA-Asp
  1411. Streptomyces sp. NPDC057697 tRNA-Asp
  1412. Streptomyces sp. NPDC057740 tRNA-Asp
  1413. Streptomyces sp. NPDC057748 tRNA-Asp
  1414. Streptomyces sp. NPDC057888 tRNA-Asp
  1415. Streptomyces sp. NPDC058051 tRNA-Asp
  1416. Streptomyces sp. NPDC059919 tRNA-Asp
  1417. Streptomyces sp. NPDC059990 tRNA-Asp
  1418. Streptomyces wedmorensis tRNA-Asp
  1419. Tenuibacillus multivorans tRNA-Asp
  1420. Terribacillus aidingensis tRNA-Asp
  1421. Terribacillus saccharophilus tRNA-Asp
  1422. Terribacillus halophilus tRNA-Asp
  1423. Terribacillus saccharophilus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1424. Terribacillus jepli Terribacillus sp. 179-K 1B1 HS tRNA-Asp
  1425. Terribacillus sp. FSL K6-0262 tRNA-Asp
  1426. Terribacillus sp. JSM ZJ617 tRNA-Asp
  1427. Terrihalobacillus insolitus tRNA-Asp
  1428. Thalassobacillus devorans tRNA-Asp
  1429. Thalassobacillus hwangdonensis tRNA-Asp
  1430. Thalassobacillus pellis tRNA-Asp
  1431. Thalassobacillus sp. B23F22_16 tRNA-Asp
  1432. Thalassobacillus sp. FIB228 tRNA-Asp
  1433. Thermoproteota archaeon tRNA-Asp
  1434. Tigheibacillus halophilus tRNA-Asp
  1435. Tunicatimonas sp. tRNA-Asp
  1436. uncultured Bacillus sp. tRNA
  1437. uncultured Cerasibacillus sp. tRNA
  1438. uncultured Cytobacillus sp. tRNA
  1439. uncultured Halalkalibacter sp. tRNA
  1440. uncultured Halobacillus sp. tRNA
  1441. uncultured Lentibacillus sp. tRNA
  1442. uncultured Melghiribacillus sp. tRNA
  1443. uncultured Oceanobacillus sp. tRNA
  1444. uncultured Paucisalibacillus sp. tRNA
  1445. uncultured Peribacillus sp. tRNA
  1446. uncultured Rossellomorea sp. tRNA
  1447. uncultured Ureibacillus sp. tRNA
  1448. Ureibacillus sp. tRNA-Asp
  1449. Vibrio cholerae tRNA-Asp
  1450. Vicingaceae bacterium tRNA-Asp
  1451. Virgibacillus ainsalahensis tRNA-Asp
  1452. Virgibacillus alimentarius tRNA-Asp
  1453. Virgibacillus byunsanensis tRNA-Asp
  1454. Virgibacillus chiguensis tRNA-Asp
  1455. Virgibacillus dokdonensis tRNA-Asp
  1456. Virgibacillus flavescens tRNA-Asp
  1457. Virgibacillus halodenitrificans tRNA-Asp
  1458. Virgibacillus indicus tRNA-Asp
  1459. Virgibacillus salexigens tRNA-Asp
  1460. Virgibacillus kekensis tRNA-Asp
  1461. Virgibacillus kimchii tRNA-Asp
  1462. Virgibacillus litoralis tRNA-Asp
  1463. Virgibacillus salexigens tRNA-Asp
  1464. Virgibacillus natechei tRNA-Asp
  1465. Virgibacillus necropolis tRNA-Asp
  1466. Virgibacillus oceani tRNA-Asp
  1467. Virgibacillus pantothenticus tRNA-Asp
  1468. Virgibacillus phasianinus tRNA-Asp
  1469. Virgibacillus profundi tRNA-Asp
  1470. Virgibacillus proomii tRNA-Asp
  1471. Virgibacillus salarius tRNA-Asp
  1472. Virgibacillus salexigens tRNA-Asp
  1473. Virgibacillus saliphilus tRNA-Asp
  1474. Virgibacillus sediminis tRNA-Asp
  1475. Paracerasibacillus soli tRNA-Asp
  1476. Virgibacillus sp. 19R1-5 tRNA-Asp
  1477. Virgibacillus sp. 6R tRNA-Asp
  1478. Virgibacillus sp. 7505 tRNA-Asp
  1479. Virgibacillus sp. AGTR tRNA-Asp
  1480. Virgibacillus tibetensis Virgibacillus sp. C22-A2 tRNA-Asp
  1481. Virgibacillus sp. CBA3643 tRNA-Asp
  1482. Virgibacillus sp. CM-4 tRNA-Asp
  1483. Virgibacillus sp. DJP39 tRNA-Asp
  1484. Virgibacillus sp. (food fermentation metagenome) tRNA-Asp
  1485. Virgibacillus sp. GM2-2 tRNA-Asp
  1486. Virgibacillus sp. JSM 102003 tRNA-Asp
  1487. Virgibacillus sp. L01 tRNA-Asp
  1488. Virgibacillus sp. M23 tRNA-Asp
  1489. Virgibacillus salidurans Virgibacillus sp. NKC19-16 tRNA-Asp
  1490. Virgibacillus sp. SK37 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1491. Virgibacillus xinjiangensis tRNA-Asp
  1492. Viridibacillus arenosi FSL R5-213 tRNA-Asp
  1493. Viridibacillus arenosi tRNA-Asp
  1494. Viridibacillus arvi tRNA-Asp
  1495. Viridibacillus sp. d25.2 tRNA-Asp
  1496. Viridibacillus sp. FSL E2-0187 tRNA-Asp
  1497. Viridibacillus sp. FSL H7-0596 tRNA-Asp
  1498. Viridibacillus sp. FSL H8-0110 tRNA-Asp
  1499. Viridibacillus sp. FSL H8-0123 tRNA-Asp
  1500. Viridibacillus sp. FSL R5-0468 tRNA-Asp
  1501. Viridibacillus sp. FSL R5-0477 tRNA-Asp
  1502. Viridibacillus sp. FSL R5-0888 tRNA-Asp
  1503. Viridibacillus arvi tRNA-Asp
  1504. Viridibacillus sp. KH_047 tRNA-Asp
  1505. Viridibacillus sp. NPDC093762 tRNA-Asp
  1506. Viridibacillus sp. NPDC096237 tRNA-Asp
  1507. Viridibacillus soli tRNA-Asp
  1508. Xanthomonas citri pv. citri tRNA-Asp
  1509. Yersinia enterocolitica tRNA-Asp
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...