Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus sp. PS20 tRNA-Asp secondary structure diagram

Bacillus sp. PS20 tRNA-Asp URS00002C7A07_2954714

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCGGUAGUUCAGUUGGUUAGAAUGCCUGCCUGUCACGCAGGAGGUCGCGGGUUCGAGUCCCGUCCGGACCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1,146 other species

  1. Acinetobacter baumannii tRNA-Asp
  2. Aeromicrobium ponti tRNA-Asp
  3. Agaribacter marinus tRNA-Asp
  4. Alcaligenes phenolicus tRNA-Asp
  5. Alkalibacillus filiformis tRNA-Asp
  6. Alkalibacillus flavidus tRNA-Asp
  7. Alkalibacillus haloalkaliphilus tRNA-Asp
  8. Alkalibacillus salilacus tRNA-Asp
  9. Alkalibacillus silvisoli tRNA-Asp
  10. Alkalibacillus sp. S2W tRNA-Asp
  11. Alkalicoccobacillus gibsonii tRNA-Asp
  12. Alkalicoccobacillus murimartini tRNA-Asp
  13. Alkalihalobacillus alcalophilus tRNA-Asp
  14. Alkalihalobacillus sp. 1P02AB tRNA-Asp
  15. Shouchella hunanensis tRNA-Asp
  16. Alkalihalophilus pseudofirmus tRNA-Asp
  17. Alkalihalobacillus sp. FSL R5-0424 tRNA-Asp
  18. Alkalihalobacillus sp. FSL W8-0930 tRNA-Asp
  19. Alkalihalobacillus sp. LMS39 tRNA-Asp
  20. Alkalihalobacillus sp. LMS6 tRNA-Asp
  21. Alkalihalobacillus sp. MEB130 tRNA-Asp
  22. Alkalihalobacillus sp. NPDC078783 tRNA-Asp
  23. Alkalihalophilus lindianensis tRNA-Asp
  24. Alkalihalophilus marmarensis tRNA-Asp
  25. Alkalihalophilus pseudofirmus OF4 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  26. Alkalihalophilus sp. As8PL tRNA-Asp
  27. Allobacillus halotolerans tRNA-Asp
  28. Allobacillus sp. GCM10007489 tRNA-Asp
  29. Allobacillus sp. GCM10007490 tRNA-Asp
  30. Allobacillus sp. GCM10007491 tRNA-Asp
  31. Allobacillus sp. SKP2-8 tRNA-Asp
  32. Allobacillus salarius tRNA-Asp
  33. Allobacillus saliphilus tRNA-Asp
  34. Amphibacillus indicireducens tRNA-Asp
  35. Amphibacillus marinus tRNA_Asp_GTC
  36. Amphibacillus sp. (anaerobic digester metagenome) tRNA-Asp
  37. Amphibacillus xylanus NBRC 15112 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  38. Anaerostipes hadrus tRNA-Asp
  39. Aquibacillus albus tRNA-Asp
  40. Aquibacillus halophilus tRNA-Asp
  41. Aquibacillus koreensis tRNA-Asp
  42. Aquibacillus rhizosphaerae tRNA-Asp
  43. Aquibacillus salsiterrae tRNA-Asp
  44. Aciduricibacillus chroicocephali tRNA-Asp
  45. Bacillaceae bacterium (coal metagenome) tRNA-Asp
  46. Pradoshia eiseniae tRNA-Asp
  47. Bacillaceae bacterium HSR45 tRNA-Asp
  48. Fervidibacillus albus tRNA-Asp
  49. Fervidibacillus halotolerans tRNA-Asp
  50. Bacillaceae bacterium S4-13-56 tRNA-Asp
  51. Bacillaceae bacterium S4-13-58 tRNA-Asp
  52. Bacillaceae bacterium SAOS 7 tRNA-Asp
  53. Bacillaceae bacterium SAS-127 tRNA-Asp
  54. Radiobacillus deserti tRNA-Asp
  55. Bacilli bacterium tRNA-Asp
  56. Bacilli bacterium VT-13-104 tRNA-Asp
  57. Bacillota bacterium Lsc_1132 tRNA-Asp
  58. Bacillota bacterium tRNA-Asp
  59. Bacillus aerius tRNA-Asp
  60. Bacillus aerophilus tRNA-Asp
  61. Alkalihalobacillus alcalophilus ATCC 27647 = CGMCC 1.3604 tRNA-Asp
  62. Bacillus altitudinis 41KF2b tRNA-Asp
  63. Bacillus altitudinis A23-8 tRNA-Asp
  64. Bacillus altitudinis MN12 tRNA-Asp
  65. Bacillus altitudinis S70-5-12 tRNA-Asp
  66. Bacillus altitudinis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  67. Bacillus amyloliquefaciens CC178 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  68. Bacillus amyloliquefaciens DSM 7 = ATCC 23350 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  69. Bacillus amyloliquefaciens EBL11 tRNA-Asp
  70. Bacillus amyloliquefaciens EGD-AQ14 tRNA-Asp
  71. Bacillus amyloliquefaciens IT-45 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  72. Bacillus amyloliquefaciens KHG19 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  73. Bacillus amyloliquefaciens LFB112 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  74. Bacillus amyloliquefaciens LL3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  75. Bacillus amyloliquefaciens TA208 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  76. Bacillus amyloliquefaciens tRNA-Asp(gtc)
  77. Bacillus amyloliquefaciens UASWS BA1 tRNA-Asp
  78. Bacillus amyloliquefaciens UMAF6614 tRNA-Asp
  79. Bacillus amyloliquefaciens UMAF6639 tRNA-Asp
  80. Bacillus amyloliquefaciens XH7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  81. Bacillus atrophaeus 1942 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  82. Bacillus atrophaeus C89 tRNA-Asp
  83. Bacillus atrophaeus subsp. globigii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  84. Bacillus atrophaeus tRNA-Asp
  85. Bacillus australimaris tRNA-Asp
  86. Pseudobacillus badius tRNA-Asp
  87. Bacillus cabrialesii subsp. cabrialesii tRNA-Asp
  88. Bacillus cabrialesii subsp. tritici tRNA-Asp
  89. Bacillus cabrialesii tRNA-Asp
  90. Bacillus capparidis tRNA-Asp
  91. Bacillus carboniphilus tRNA-Asp
  92. Bacillus altitudinis tRNA-Asp
  93. Bacillus cereus tRNA-Asp
  94. Bacillus changyiensis tRNA-Asp
  95. Niallia circulans tRNA-Asp(gtc)
  96. Cytobacillus dafuensis tRNA-Asp
  97. Cytobacillus depressus tRNA-Asp
  98. [Bacillus] enclensis tRNA_Asp_GTC
  99. Niallia endozanthoxylica tRNA-Asp
  100. Bacillus firmis tRNA-Asp
  101. Cytobacillus firmus DS1 tRNA-Asp
  102. Bacillus glycinifermentans tRNA-Asp
  103. Bacillus gobiensis tRNA-Asp
  104. Bacillus haikouensis tRNA-Asp
  105. Bacillus halotolerans tRNA-Asp
  106. Bacillus haynesii tRNA-Asp
  107. Bacillus inaquosorum tRNA-Asp(gtc)
  108. Halalkalibacter krulwichiae tRNA-Asp
  109. Robertmurraya kyonggiensis tRNA-Asp
  110. Shouchella lehensis tRNA-Asp
  111. Bacillus licheniformis CG-B52 tRNA-Asp
  112. Bacillus licheniformis DSM 13 = ATCC 14580 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  113. Bacillus licheniformis LMG 17339 tRNA-Asp
  114. Bacillus licheniformis LMG 6934 tRNA-Asp
  115. Bacillus licheniformis LMG 7559 tRNA-Asp
  116. Bacillus licheniformis tRNA-Asp(gtc)
  117. Bacillus licheniformis WX-02 tRNA-Asp
  118. Peribacillus loiseleuriae tRNA-Asp
  119. Bacillus lumedeiriae tRNA-Asp
  120. Rossellomorea marisflavi tRNA-Asp
  121. Alkalihalophilus marmarensis DSM 21297 tRNA-Asp
  122. Priestia megaterium tRNA-Asp
  123. Bacillus mesophilum tRNA-Asp
  124. Bacillus mojavensis tRNA-Asp
  125. Bacillus nakamurai tRNA-Asp
  126. Halalkalibacter nanhaiisediminis tRNA-Asp
  127. Niallia nealsonii AAU1 tRNA-Asp
  128. Niallia nealsonii tRNA-Asp
  129. Neobacillus notoginsengisoli tRNA-Asp
  130. Bacillus obstructivus tRNA-Asp
  131. Cytobacillus oceanisediminis 2691 tRNA-Asp
  132. Halalkalibacter okhensis tRNA-Asp
  133. Halalkalibacterium halodurans tRNA-Asp
  134. Bacillus oleivorans tRNA-Asp
  135. Bacillus paralicheniformis ATCC 9945a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  136. Bacillus paralicheniformis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  137. Alkalicoccobacillus plakortidis tRNA-Asp
  138. Alkalihalobacillus pseudalcaliphilus tRNA-Asp
  139. Alkalihalophilus pseudofirmus tRNA-Asp
  140. Bacillus pumilus ATCC 7061 tRNA-Asp
  141. Bacillus pumilus DW2J2 tRNA-Asp
  142. Bacillus pumilus SAFR-032 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  143. Bacillus pumilus sxm20-2 tRNA-Asp
  144. Bacillus pumilus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  145. Bacillus rugosus tRNA-Asp
  146. Bacillus safensis FO-36b tRNA-Asp
  147. Bacillus safensis subsp. safensis tRNA-Asp
  148. Bacillus safensis tRNA-Asp
  149. Bacillus seohaeanensis tRNA-Asp
  150. Bacillus siamensis tRNA-Asp
  151. Bacillus solimangrovi tRNA-Asp
  152. Bacillus sonorensis L12 tRNA-Asp
  153. Bacillus sonorensis tRNA-Asp
  154. Bacillus sp. 005/A4HT-01/001 tRNA-Asp
  155. Bacillus sp. 0102A tRNA-Asp
  156. Bacillus sp. 0209A tRNA-Asp
  157. Bacillus sp. 0909A tRNA-Asp
  158. Bacillus sp. 1021 tRNA-Asp
  159. Bacillus sp. 1735sda2 tRNA-Asp
  160. Bacillus sp. 179-C3.3 HS tRNA-Asp
  161. Bacillus sp. 1NLA3E tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  162. Bacillus sp. 1P10SD tRNA-Asp
  163. Bacillus sp. 1s-1 tRNA-Asp
  164. Bacillus sp. 2211 tRNA-Asp
  165. Bacillus sp. 275 tRNA-Asp
  166. Bacillus sp. 28A-2 tRNA-Asp
  167. Bacillus sp. 2_A_57_CT2 tRNA-Asp
  168. Bacillus sp. 31 tRNA-Asp
  169. Bacillus sp. 348 tRNA-Asp
  170. Bacillus sp. 349Y tRNA-Asp
  171. Bacillus sp. 3a tRNA-Asp
  172. Bacillus sp. 5001 tRNA-Asp
  173. Bacillus sp. 5B6 tRNA-Asp
  174. Bacillus sp. 7504-2 tRNA-Asp
  175. Bacillus sp. 7520-S tRNA-Asp
  176. Bacillus sp. 7788 tRNA-Asp
  177. Bacillus sp. 7884-1 tRNA-Asp
  178. Bacillus sp. 7D3 tRNA-Asp
  179. Bacillus sp. 916 tRNA-Asp
  180. Bacillus sp. 9J tRNA-Asp
  181. Bacillus sp. A053 tRNA-Asp
  182. Bacillus sp. A1 tRNA-Asp
  183. Bacillus sp. A31 tRNA-Asp
  184. Bacillus sp. AAVF1 tRNA-Asp
  185. Bacillus sp. AFS006103 tRNA-Asp
  186. Bacillus sp. AFS015802 tRNA-Asp
  187. Bacillus sp. AFS031507 tRNA-Asp
  188. Bacillus sp. AFS040349 tRNA-Asp
  189. Bacillus sp. AFS073361 tRNA-Asp
  190. Bacillus sp. AG1 tRNA-Asp
  191. Bacillus sp. AM1(2019) tRNA-Asp
  192. Bacillus sp. AM 13(2015) tRNA-Asp
  193. Bacillus sp. AN2 tRNA-Asp
  194. Bacillus sp. ANT_WA51 tRNA-Asp
  195. Bacillus siamensis Bacillus sp. B01(2024) tRNA-Asp
  196. Bacillus sp. B1(2022) tRNA-Asp
  197. Bacillus sp. B18(2022) tRNA-Asp
  198. Bacillus sp. B19-2 tRNA-Asp
  199. Bacillus sp. B1-b2 tRNA-Asp
  200. Bacillus sp. B2(2022) tRNA-Asp
  201. Bacillus sp. B28 tRNA-Asp
  202. Bacillus sp. B6(2022) tRNA-Asp
  203. Bacillus sp. B8(2022) tRNA-Asp
  204. Bacillus sp. BAC tRNA-Asp
  205. Bacillus sp. BC1-43 tRNA-Asp
  206. Bacillus sp. BD48 tRNA-Asp
  207. Bacillus sp. BH072 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  208. Bacillus sp. BHET2 tRNA-Asp
  209. Bacillus sp. B-jedd tRNA-Asp
  210. Bacillus sp. B.PNR1 tRNA-Asp
  211. Bacillus sp. B.PNR2 tRNA-Asp
  212. Bacillus sp. BR_10 tRNA-Asp
  213. Bacillus sp. BS1807G30 tRNA-Asp
  214. Bacillus sp. BS3(2021) tRNA-Asp
  215. Bacillus sp. BT1B_CT2 tRNA-Asp
  216. Bacillus sp. Bva_UNVM-123 tRNA-Asp
  217. Bacillus sp. Bvel1 tRNA-Asp
  218. Bacillus sp. C10(2022) tRNA-Asp
  219. Bacillus sp. C11(2022) tRNA-Asp
  220. Bacillus sp. C1-1 tRNA-Asp
  221. Bacillus sp. C1(2022) tRNA-Asp
  222. Bacillus sp. C15(2022) tRNA-Asp
  223. Bacillus sp. C15 tRNA-Asp
  224. Bacillus sp. C2(2022) tRNA-Asp
  225. Bacillus sp. C28GYM-DRY-1 tRNA-Asp
  226. Bacillus sp. C3(2022) tRNA-Asp
  227. Bacillus sp. C37plca tRNA-Asp
  228. Bacillus sp. C5(2022) tRNA-Asp
  229. Bacillus sp. CCNWLCWHY013 tRNA-Asp
  230. Bacillus sp. CECT 9360 tRNA-Asp
  231. Bacillus sp. CH30_1T tRNA-Asp
  232. Bacillus sp. CJCL2 tRNA-Asp
  233. Bacillus sp. CMAA 1185 tRNA-Asp
  234. Bacillus sp. CMF12 tRNA-Asp
  235. Bacillus sp. CN2 tRNA-Asp
  236. Bacillus sp. CPSM8 tRNA-Asp
  237. Bacillus aerolatus tRNA-Asp
  238. Bacillus sp. D12 tRNA-Asp
  239. Bacillus sp. DM2 tRNA-Asp
  240. Bacillus sp. DNRA2 tRNA-Asp
  241. Metabacillus sediminilitoris tRNA-Asp
  242. Bacillus sp. DSM 27956 tRNA-Asp
  243. Bacillus sp. DTU_2020_1000418_1_SI_GHA_SEK_038 tRNA-Asp
  244. Bacillus sp. EB106-08-02-XG196 tRNA-Asp
  245. Bacillus sp. EKM213B tRNA-Asp
  246. Bacillus sp. EKM417B tRNA-Asp
  247. Bacillus sp. EKM420B tRNA-Asp
  248. Bacillus sp. es.034 tRNA-Asp
  249. Bacillus sp. EU52 tRNA-Asp
  250. Bacillus sp. EU55 tRNA-Asp
  251. Bacillus sp. EU62 tRNA-Asp
  252. Bacillus sp. EU63 tRNA-Asp
  253. Bacillus sp. FCW2 tRNA-Asp
  254. Bacillus sp. FJAT-14266 tRNA-Asp
  255. Bacillus sp. FJAT-21945 tRNA-Asp
  256. Bacillus sp. FJAT-21955 tRNA-Asp
  257. Bacillus sp. FJAT-27231 tRNA-Asp
  258. Bacillus sp. FJAT-27445 tRNA-Asp
  259. Bacillus sp. FJAT-27916 tRNA-Asp
  260. Bacillus sp. FJAT-27986 tRNA-Asp
  261. Bacillus sp. FJAT-42376 tRNA-Asp
  262. Bacillus sp. FJAT-49711 tRNA-Asp
  263. Bacillus kandeliae Bacillus sp. FJAT-52991 tRNA-Asp
  264. Bacillus sp. FJAT-53060 tRNA-Asp
  265. Bacillus sp. FMQ74 tRNA-Asp
  266. Bacillus sp. FSL E2-0174 tRNA-Asp
  267. Bacillus sp. FSL H7-0578 tRNA-Asp
  268. Bacillus sp. FSL H8-0512 tRNA-Asp
  269. Bacillus sp. FSL H8-0515 tRNA-Asp
  270. Bacillus sp. FSL H8-0516 tRNA-Asp
  271. Bacillus sp. FSL K6-0036 tRNA-Asp
  272. Bacillus sp. FSL K6-0046 tRNA-Asp
  273. Bacillus sp. FSL K6-0047 tRNA-Asp
  274. Bacillus sp. FSL K6-0138 tRNA-Asp
  275. Bacillus sp. FSL K6-0250 tRNA-Asp
  276. Bacillus sp. FSL K6-0255 tRNA-Asp
  277. Bacillus sp. FSL K6-0764 tRNA-Asp
  278. Bacillus sp. FSL K6-0923 tRNA-Asp
  279. Bacillus sp. FSL K6-0947 tRNA-Asp
  280. Bacillus sp. FSL K6-0972 tRNA-Asp
  281. Bacillus sp. FSL K6-0993 tRNA-Asp
  282. Bacillus sp. FSL K6-0994 tRNA-Asp
  283. Bacillus sp. FSL K6-0998 tRNA-Asp
  284. Bacillus sp. FSL K6-1000 tRNA-Asp
  285. Bacillus sp. FSL K6-1003 tRNA-Asp
  286. Bacillus sp. FSL K6-1005 tRNA-Asp
  287. Bacillus sp. FSL K6-1006 tRNA-Asp
  288. Bacillus sp. FSL K6-1012 tRNA-Asp
  289. Bacillus sp. FSL K6-1033 tRNA-Asp
  290. Bacillus sp. FSL K6-1106 tRNA-Asp
  291. Bacillus sp. FSL K6-1109 tRNA-Asp
  292. Bacillus sp. FSL K6-1145 tRNA-Asp
  293. Bacillus sp. FSL K6-1234 tRNA-Asp
  294. Bacillus sp. FSL K6-1284 tRNA-Asp
  295. Bacillus sp. FSL K6-1336 tRNA-Asp
  296. Bacillus sp. FSL K6-1366 tRNA-Asp
  297. Bacillus sp. FSL K6-1560 tRNA-Asp
  298. Bacillus sp. FSL K6-2431 tRNA-Asp
  299. Bacillus sp. FSL K6-2819 tRNA-Asp
  300. Bacillus sp. FSL K6-2837 tRNA-Asp
  301. Bacillus sp. FSL K6-2839 tRNA-Asp
  302. Bacillus sp. FSL K6-2841 tRNA-Asp
  303. Bacillus sp. FSL K6-2860 tRNA-Asp
  304. Bacillus sp. FSL K6-2861 tRNA-Asp
  305. Bacillus sp. FSL K6-2865 tRNA-Asp
  306. Bacillus sp. FSL K6-2869 tRNA-Asp
  307. Bacillus sp. FSL K6-2971 tRNA-Asp
  308. Bacillus sp. FSL K6-3149 tRNA-Asp
  309. Bacillus sp. FSL K6-3154 tRNA-Asp
  310. Bacillus sp. FSL K6-3176 tRNA-Asp
  311. Bacillus sp. FSL K6-3200 tRNA-Asp
  312. Bacillus sp. FSL K6-3221 tRNA-Asp
  313. Bacillus sp. FSL K6-3312 tRNA-Asp
  314. Bacillus sp. FSL K6-3458 tRNA-Asp
  315. Bacillus sp. FSL K6-3459 tRNA-Asp
  316. Bacillus sp. FSL K6-3846 tRNA-Asp
  317. Bacillus sp. FSL K6-4563 tRNA-Asp
  318. Bacillus sp. FSL K6-5915 tRNA-Asp
  319. Bacillus sp. FSL K6-6483 tRNA-Asp
  320. Bacillus sp. FSL K6-6540 tRNA-Asp
  321. Bacillus sp. FSL K6-8391 tRNA-Asp
  322. Bacillus sp. FSL L8-0167 tRNA-Asp
  323. Bacillus sp. FSL L8-0173 tRNA-Asp
  324. Bacillus sp. FSL L8-0186 tRNA-Asp
  325. Bacillus sp. FSL L8-0193 tRNA-Asp
  326. Bacillus sp. FSL L8-0215 tRNA-Asp
  327. Bacillus sp. FSL L8-0222 tRNA-Asp
  328. Bacillus sp. FSL L8-0358 tRNA-Asp
  329. Bacillus sp. FSL L8-0528 tRNA-Asp
  330. Bacillus sp. FSL L8-0533 tRNA-Asp
  331. Bacillus sp. FSL L8-0654 tRNA-Asp
  332. Bacillus sp. FSL L8-0661 tRNA-Asp
  333. Bacillus sp. FSL M7-0003 tRNA-Asp
  334. Bacillus sp. FSL M7-0307 tRNA-Asp
  335. Bacillus sp. FSL M7-0417 tRNA-Asp
  336. Bacillus sp. FSL M7-0558 tRNA-Asp
  337. Bacillus sp. FSL M7-0791 tRNA-Asp
  338. Bacillus sp. FSL M7-1004 tRNA-Asp
  339. Bacillus sp. FSL M8-0025 tRNA-Asp
  340. Bacillus sp. FSL M8-0049 tRNA-Asp
  341. Bacillus sp. FSL M8-0052 tRNA-Asp
  342. Bacillus sp. FSL M8-0054 tRNA-Asp
  343. Bacillus sp. FSL M8-0071 tRNA-Asp
  344. Bacillus sp. FSL M8-0077 tRNA-Asp
  345. Bacillus sp. FSL M8-0133 tRNA-Asp
  346. Bacillus sp. FSL M8-0166 tRNA-Asp
  347. Bacillus sp. FSL M8-0168 tRNA-Asp
  348. Bacillus sp. FSL M8-0256 tRNA-Asp
  349. Bacillus sp. FSL M8-0266 tRNA-Asp
  350. Bacillus sp. FSL M8-0277 tRNA-Asp
  351. Bacillus sp. FSL M8-0315 tRNA-Asp
  352. Bacillus sp. FSL M8-0326 tRNA-Asp
  353. Bacillus sp. FSL M8-0350 tRNA-Asp
  354. Bacillus sp. FSL M8-0359 tRNA-Asp
  355. Bacillus sp. FSL P2-0026 tRNA-Asp
  356. Bacillus sp. FSL P2-0069 tRNA-Asp
  357. Bacillus sp. FSL P2-0092 tRNA-Asp
  358. Bacillus sp. FSL P4-0248 tRNA-Asp
  359. Bacillus sp. FSL P4-0290 tRNA-Asp
  360. Bacillus sp. FSL P4-0322 tRNA-Asp
  361. Bacillus sp. FSL P4-0334 tRNA-Asp
  362. Bacillus sp. FSL R5-0286 tRNA-Asp
  363. Bacillus sp. FSL R5-0293 tRNA-Asp
  364. Bacillus sp. FSL R5-0394 tRNA-Asp
  365. Bacillus sp. FSL R5-0397 tRNA-Asp
  366. Bacillus sp. FSL R5-0416 tRNA-Asp
  367. Bacillus sp. FSL R5-0418 tRNA-Asp
  368. Bacillus sp. FSL R5-0422 tRNA-Asp
  369. Bacillus sp. FSL R5-0431 tRNA-Asp
  370. Bacillus sp. FSL R5-0432 tRNA-Asp
  371. Bacillus sp. FSL R5-0434 tRNA-Asp
  372. Bacillus sp. FSL R5-0439 tRNA-Asp
  373. Bacillus sp. FSL R5-0443 tRNA-Asp
  374. Bacillus sp. FSL R5-0447 tRNA-Asp
  375. Bacillus sp. FSL R5-0512 tRNA-Asp
  376. Bacillus sp. FSL R5-0523 tRNA-Asp
  377. Bacillus sp. FSL R5-0560 tRNA-Asp
  378. Bacillus sp. FSL R5-0576 tRNA-Asp
  379. Bacillus sp. FSL R5-0586 tRNA-Asp
  380. Bacillus sp. FSL R5-0593 tRNA-Asp
  381. Bacillus sp. FSL R5-0603 tRNA-Asp
  382. Bacillus sp. FSL R5-0654 tRNA-Asp
  383. Bacillus sp. FSL R5-0659 tRNA-Asp
  384. Bacillus sp. FSL R5-0712 tRNA-Asp
  385. Bacillus sp. FSL R5-0820 tRNA-Asp
  386. Bacillus sp. FSL R7-0166 tRNA-Asp
  387. Bacillus sp. FSL R7-0229 tRNA-Asp
  388. Bacillus sp. FSL R7-0646 tRNA-Asp
  389. Bacillus sp. FSL R7-0651 tRNA-Asp
  390. Bacillus sp. FSL R7-0672 tRNA-Asp
  391. Bacillus sp. FSL R7-0675 tRNA-Asp
  392. Bacillus sp. FSL R7-0685 tRNA-Asp
  393. Bacillus sp. FSL R7-0718 tRNA-Asp
  394. Bacillus sp. FSL W7-1034 tRNA-Asp
  395. Bacillus sp. FSL W7-1085 tRNA-Asp
  396. Bacillus sp. FSL W7-1092 tRNA-Asp
  397. Bacillus sp. FSL W7-1282 tRNA-Asp
  398. Bacillus sp. FSL W7-1321 tRNA-Asp
  399. Bacillus sp. FSL W7-1336 tRNA-Asp
  400. Bacillus sp. FSL W7-1346 tRNA-Asp
  401. Bacillus sp. FSL W7-1354 tRNA-Asp
  402. Bacillus sp. FSL W7-1360 tRNA-Asp
  403. Bacillus sp. FSL W7-1582 tRNA-Asp
  404. Bacillus sp. FSL W8-0006 tRNA-Asp
  405. Bacillus sp. FSL W8-0183 tRNA-Asp
  406. Bacillus sp. FSL W8-0445 tRNA-Asp
  407. Bacillus sp. FSL W8-0502 tRNA-Asp
  408. Bacillus sp. FSL W8-0629 tRNA-Asp
  409. Bacillus sp. FSL W8-0645 tRNA-Asp
  410. Bacillus sp. FSL W8-0672 tRNA-Asp
  411. Bacillus sp. FSL W8-0812 tRNA-Asp
  412. Bacillus sp. FSL W8-0848 tRNA-Asp
  413. Bacillus sp. FSL W8-0920 tRNA-Asp
  414. Bacillus sp. FSL W8-0940 tRNA-Asp
  415. Bacillus sp. FSL W8-1122 tRNA-Asp
  416. Bacillus sp. FSL W8-1141 tRNA-Asp
  417. Bacillus sp. FSL W8-1143 tRNA-Asp
  418. Bacillus sp. FSL W8-1202 tRNA-Asp
  419. Bacillus sp. FW1 tRNA-Asp
  420. Bacillus sp. G1(2015b) tRNA-Asp
  421. Bacillus sp. GBSC66 tRNA-Asp
  422. Bacillus sp. GBSW19 tRNA-Asp
  423. Bacillus sp. GBSW2 tRNA-Asp
  424. Bacillus sp. Gen2 tRNA-Asp
  425. Bacillus sp. Gen3 tRNA-Asp
  426. Bacillus sp. GZB tRNA-Asp
  427. Bacillus sp. H15-1 tRNA-Asp
  428. Bacillus sp. HMF5848 tRNA-Asp
  429. Bacillus sp. HMG tRNA-Asp
  430. Bacillus sp. HNA3 tRNA-Asp
  431. Bacillus sp. HSf4 tRNA-Asp
  432. Bacillus sp. I-2 tRNA-Asp
  433. Metabacillus arenae tRNA-Asp
  434. Bacillus sp. ICE1 tRNA-Asp
  435. Bacillus sp. IG2 tRNA-Asp
  436. Bacillus sp. IG6 tRNA-Asp
  437. Bacillus sp. (in: firmicutes) (in: firmicutes) tRNA-Asp
  438. Bacillus sp. IS1 tRNA-Asp
  439. Bacillus sp. ISL-18 tRNA-Asp
  440. Bacillus sp. ISL-26 tRNA-Asp
  441. Bacillus sp. ISL-32 tRNA-Asp
  442. Bacillus sp. ISL-40 tRNA-Asp
  443. Bacillus sp. ISL-46 tRNA-Asp
  444. Bacillus sp. ISL-47 tRNA-Asp
  445. Bacillus sp. ISL-51 tRNA-Asp
  446. Bacillus sp. ISL-75 tRNA-Asp
  447. Bacillus sp. ISL-77 tRNA-Asp
  448. Bacillus sp. ISL-7 tRNA-Asp
  449. Bacillus sp. IT-13CA1 tRNA-Asp
  450. Bacillus spizizenii ATCC 6633 = JCM 2499 tRNA-Asp
  451. Bacillus spizizenii str. W23 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  452. Bacillus spizizenii tRNA-Asp(gtc)
  453. Bacillus spizizenii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  454. Bacillus spizizenii TU-B-10 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  455. Bacillus sp. J14TS2 tRNA-Asp
  456. Bacillus sp. J41TS8 tRNA-Asp
  457. Bacillus sp. J5TS4 tRNA-Asp
  458. Bacillus sp. JHAA tRNA-Asp
  459. Bacillus sp. JJ1474 tRNA-Asp
  460. Bacillus sp. JJ1503 tRNA-Asp
  461. Bacillus sp. JJ1532 tRNA-Asp
  462. Bacillus sp. JJ1773 tRNA-Asp
  463. Bacillus sp. JJ353 tRNA-Asp
  464. Bacillus sp. JJ634 tRNA-Asp
  465. Bacillus sp. JJ675 tRNA-Asp
  466. Bacillus sp. JNUCC-21 tRNA-Asp
  467. Bacillus sp. JNUCC-22 tRNA-Asp
  468. Bacillus sp. JNUCC-24 tRNA-Asp
  469. Bacillus sp. JRC01 tRNA-Asp
  470. Bacillus sp. JS tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  471. Bacillus sp. KBS0812 tRNA-Asp
  472. Bacillus sp. KH172YL63 tRNA-Asp
  473. Bacillus sp. KICET-1 tRNA-Asp
  474. Bacillus sp. KICET-3 tRNA-Asp
  475. Bacillus sp. L_1B0_12 tRNA-Asp
  476. Bacillus sp. L381 tRNA-Asp
  477. Bacillus sp. LB7 tRNA-Asp
  478. Bacillus sp. Leaf406 tRNA-Asp
  479. Bacillus sp. Leaf49 tRNA-Asp
  480. Neobacillus massiliamazoniensis tRNA-Asp
  481. Bacillus sp. LJBS06 tRNA-Asp
  482. Bacillus sp. LJBS17 tRNA-Asp
  483. Bacillus sp. LJBV19 tRNA-Asp
  484. Bacillus sp. LK10 tRNA-Asp
  485. Bacillus sp. LK7 tRNA-Asp
  486. Bacillus sp. LL01 tRNA-Asp
  487. Bacillus sp. LLTC93 tRNA-Asp
  488. Bacillus sp. LM 4-2 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  489. Bacillus sp. LMB3902 tRNA-Asp
  490. Bacillus sp. LNXM10 tRNA-Asp
  491. Bacillus sp. LNXM12-1 tRNA-Asp
  492. Bacillus sp. LNXM12-2 tRNA-Asp
  493. Bacillus sp. LNXM65 tRNA-Asp
  494. Bacillus sp. LR_5 tRNA-Asp
  495. Bacillus sp. LR_6 tRNA-Asp
  496. Bacillus sp. LUNF1 tRNA-Asp
  497. Bacillus sp. LYLB4 tRNA-Asp
  498. Bacillus velezensis tRNA-Asp
  499. Bacillus sp. M 2-6 tRNA-Asp
  500. Bacillus sp. MAG717A tRNA-Asp
  501. Bacillus sp. Man122 tRNA-Asp
  502. Bacillus sp. MBGLi79 tRNA-Asp
  503. Bacillus sp. MBGLi97 tRNA-Asp
  504. Bacillus sp. MD-5 tRNA-Asp
  505. Bacillus sp. MKU004 tRNA-Asp
  506. Bacillus sp. MRMR6 tRNA-Asp
  507. Bacillus sp. ms-22 tRNA-Asp
  508. Bacillus sp. MT(2024) tRNA-Asp
  509. Bacillus sp. MT tRNA-Asp
  510. Bacillus sp. MUM 116 tRNA-Asp
  511. Bacillus sp. MZGC1 tRNA-Asp
  512. Bacillus sp. N12A5 tRNA-Asp
  513. Bacillus sp. N13C7 tRNA-Asp
  514. Cytobacillus sp. NCCP-133 tRNA-Asp
  515. Bacillus sp. NEAU-16 tRNA-Asp
  516. Bacillus sp. NEAU-242-2 tRNA-Asp
  517. Bacillus sp. NEAU-CP5 tRNA-Asp
  518. Bacillus sp. Nf3 tRNA-Asp
  519. Bacillus sp. NIO_002 tRNA-Asp
  520. Bacillus sp. NMCC46 tRNA-Asp
  521. Bacillus sp. NMCC4 tRNA-Asp
  522. Bacillus sp. NMCN1 tRNA-Asp
  523. Bacillus sp. NMCN6 tRNA-Asp
  524. Bacillus sp. NMTD17 tRNA-Asp
  525. Bacillus sp. NPDC093026 tRNA-Asp
  526. Bacillus sp. NSP9.1 tRNA-Asp
  527. Bacillus sp. NTK034 tRNA-Asp
  528. Bacillus sp. NTK074B tRNA-Asp
  529. Bacillus sp. OAE578 tRNA-Asp
  530. Bacillus spongiae tRNA-Asp
  531. Bacillus sp. P003 tRNA-Asp
  532. Alkalicoccobacillus porphyridii tRNA-Asp
  533. Bacillus sp. PAMC22265 tRNA-Asp
  534. Bacillus sp. PAMC26543 tRNA-Asp
  535. Bacillus sp. PAMC28571 tRNA-Asp
  536. Bacillus sp. PAMC28748 tRNA-Asp
  537. Bacillus sp. Pc3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  538. Bacillus sp. PDNC022 tRNA-Asp
  539. Bacillus sp. PK3_68 tRNA-Asp
  540. Bacillus sp. PM8313 tRNA-Asp
  541. Bacillus sp. PS108 tRNA-Asp
  542. Bacillus sp. PS11(2022) tRNA-Asp
  543. Bacillus sp. PS18 tRNA-Asp
  544. Bacillus sp. PS194 tRNA-Asp
  545. Bacillus sp. PS196 tRNA-Asp
  546. Bacillus sp. PS210 tRNA-Asp
  547. Bacillus sp. PS217 tRNA-Asp
  548. Bacillus sp. PS237 tRNA-Asp
  549. Bacillus sp. PS65 tRNA-Asp
  550. Bacillus sp. PS68 tRNA-Asp
  551. Bacillus sp. PS93 tRNA-Asp
  552. Bacillus sp. PS95 tRNA-Asp
  553. Bacillus sp. PsM16 tRNA-Asp
  554. Bacillus sp. PW192 tRNA-Asp
  555. Bacillus sp. R45 tRNA-Asp
  556. Bacillus sp. Rc4 tRNA-Asp
  557. Bacillus sp. RHF6 tRNA-Asp
  558. Bacillus sp. RHFS10 tRNA-Asp
  559. Bacillus sp. RHFS18 tRNA-Asp
  560. Bacillus ayatagriensis Bacillus sp. RMG-6 tRNA-Asp
  561. Bacillus sp. Root920 tRNA-Asp
  562. Bacillus sp. RP12 tRNA-Asp
  563. Bacillus sp. Ru63 tRNA-Asp
  564. Bacillus sp. S10C12M tRNA-Asp
  565. Bacillus sp. S17B2 tRNA-Asp
  566. Bacillus sp. S20C3 tRNA-Asp
  567. Bacillus sp. S2(2019) tRNA-Asp
  568. Bacillus sp. S3 tRNA-Asp
  569. Bacillus sp. SA1-12 tRNA-Asp
  570. Bacillus sp. SB49 tRNA-Asp
  571. Rossellomorea sedimentorum Bacillus sp. SCS-153A tRNA-Asp
  572. Bacillus sp. SD088 tRNA-Asp
  573. Bacillus safensis tRNA-Asp
  574. Bacillus sp. SDLI1 tRNA-Asp
  575. Bacillus sp. SG20001 tRNA-Asp
  576. Bacillus sp. SG20032 tRNA-Asp
  577. Bacillus sp. SG20033 tRNA-Asp
  578. Bacillus sp. sid0103 tRNA-Asp
  579. Bacillus sp. SIMBA_005 tRNA-Asp
  580. Bacillus sp. SIMBA_006 tRNA-Asp
  581. Bacillus sp. SIMBA_008 tRNA-Asp
  582. Bacillus sp. SIMBA_026 tRNA-Asp
  583. Bacillus sp. SIMBA_031 tRNA-Asp
  584. Bacillus sp. SIMBA_033 tRNA-Asp
  585. Bacillus sp. SIMBA_154 tRNA-Asp
  586. Bacillus sp. SIMBA_161 tRNA-Asp
  587. Bacillus sp. SJS tRNA-Asp
  588. Bacillus sp. SKDU12 tRNA-Asp
  589. Bacillus salacetis tRNA-Asp
  590. Bacillus sp. SL00103 tRNA-Asp
  591. Bacillus sp. SL112 tRNA-Asp
  592. Bacillus sp. SLBN-46 tRNA-Asp
  593. Bacillus sp. SN1 tRNA-Asp
  594. Bacillus sp. SN32 tRNA-Asp
  595. Bacillus sp. SORGH_AS_0510 tRNA-Asp
  596. Paenibacillus sp. PL91 tRNA-Asp
  597. Bacillus paralicheniformis tRNA-Asp
  598. Bacillus sp. SW14 tRNA-Asp
  599. Bacillus sp. T17B1 tRNA-Asp
  600. Bacillus sp. T2.9-1 tRNA-Asp(gtc)
  601. Bacillus sp. T9C1 tRNA-Asp
  602. Bacillus sp. TBS-096 tRNA-Asp
  603. Bacillus sp. TH007 tRNA-Asp
  604. Bacillus sp. TJS119 tRNA-Asp
  605. Bacillus sp. TS-2 tRNA-Asp
  606. Bacillus sp. TSA-4 tRNA-Asp
  607. Bacillus sp. UMB0899 tRNA-Asp
  608. Niallia alba tRNA-Asp
  609. Bacillus sp. V26 tRNA-Asp
  610. Bacillus sp. V3 tRNA-Asp
  611. Bacillus sp. V59.32a tRNA-Asp
  612. Bacillus salipaludis tRNA-Asp
  613. Bacillus sp. WP8 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  614. Bacillus sp. WR11 tRNA-Asp
  615. Bacillus sp. WR12 tRNA-Asp
  616. Bacillus sp. WR13 tRNA-Asp
  617. Bacillus sp. X2(2017) (2017) tRNA-Asp
  618. Bacillus yapensis tRNA-Asp
  619. Bacillus sp. XZ-5 tRNA-Asp
  620. Bacillus sp. Y1 tRNA-Asp
  621. Bacillus sp. Y3 tRNA-Asp
  622. Bacillus sp. YBsi01 tRNA-Asp
  623. Bacillus sp. YBWC18 tRNA-Asp
  624. Bacillus sp. YC2 tRNA-Asp
  625. Bacillus sp. YKCMOAS1 tRNA-Asp
  626. Neobacillus piezotolerans tRNA-Asp
  627. Bacillus sp. YP1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  628. Bacillus sp. z60-10 tRNA-Asp
  629. Bacillus sp. z60-11 tRNA-Asp
  630. Bacillus sp. z60-18 tRNA-Asp
  631. Bacillus sp. ZCB01 tRNA-Asp
  632. Bacillus sp. ZHX3 tRNA-Asp
  633. Bacillus sp. ZY-1-1 tRNA-Asp
  634. Bacillus sp. ZZV12-4809 tRNA-Asp
  635. Bacillus stercoris tRNA-Asp
  636. Bacillus stratosphericus tRNA-Asp
  637. Halalkalibacter suaedae Bacillus suaedae tRNA-Asp
  638. Bacillus subtilis BEST7003 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  639. Bacillus subtilis BEST7613 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  640. Bacillus subtilis BSn5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  641. Bacillus subtilis E1 tRNA-Asp-GTC
  642. Bacillus subtilis HJ5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  643. Bacillus subtilis J22 tRNA-Asp
  644. Bacillus subtilis J23 tRNA-Asp
  645. Bacillus subtilis J24 tRNA-Asp
  646. Bacillus subtilis J25 tRNA-Asp
  647. Bacillus subtilis J26 tRNA-Asp
  648. Bacillus subtilis J27 tRNA-Asp
  649. Bacillus subtilis KCTC 1028 = ATCC 6051a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  650. Bacillus subtilis MB73/2 tRNA-Asp
  651. Bacillus subtilis PY79 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  652. Bacillus subtilis QB928 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  653. Bacillus subtilis QH-1 tRNA-Asp
  654. Bacillus subtilis subsp. globigii tRNA-Asp
  655. Bacillus inaquosorum KCTC 13429 tRNA-Asp
  656. Bacillus subtilis subsp. natto BEST195 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  657. Bacillus subtilis subsp. natto tRNA-Asp
  658. Bacillus subtilis subsp. subtilis 6051-HGW tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  659. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 tRNA-Asp
  660. Bacillus subtilis subsp. subtilis str. 168 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  661. Bacillus subtilis subsp. subtilis str. AG1839 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  662. Bacillus subtilis subsp. subtilis str. BAB-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  663. Bacillus subtilis subsp. subtilis str. BSP1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  664. Bacillus subtilis subsp. subtilis str. JH642 substr. AG174 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  665. Bacillus subtilis subsp. subtilis str. OH 131.1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  666. Bacillus subtilis subsp. subtilis str. RO-NN-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  667. Bacillus subtilis subsp. subtilis str. SC-8 tRNA-Asp
  668. Bacillus subtilis subsp. subtilis str. SMY tRNA-Asp
  669. Bacillus subtilis subsp. subtilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  670. Bacillus subtilis TO-A tRNA-Asp
  671. Bacillus subtilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  672. Bacillus subtilis XF-1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  673. Bacillus swezeyi tRNA-Asp
  674. Bacillus tequilensis tRNA-Asp(gtc)
  675. Sutcliffiella tianshenii tRNA-Asp
  676. Alkalihalobacillus trypoxylicola tRNA-Asp
  677. Bacillus vallismortis tRNA-Asp
  678. Bacillus velezensis AS43.3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  679. Bacillus velezensis CAU B946 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  680. Bacillus velezensis FZB42 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  681. Bacillus velezensis M27 tRNA-Asp
  682. Bacillus velezensis NAU-B3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  683. Bacillus velezensis NJN-6 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  684. Bacillus velezensis SQR9 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  685. Bacillus velezensis TrigoCor1448 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  686. Bacillus velezensis tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  687. Bacillus velezensis UCMB5033 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  688. Bacillus velezensis UCMB5036 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  689. Bacillus velezensis UCMB5113 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  690. Bacillus velezensis YAU B9601-Y2 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  691. Rossellomorea vietnamensis tRNA-Asp
  692. Neobacillus vireti LMG 21834 tRNA-Asp
  693. Bacillus weihaiensis tRNA-Asp
  694. Pseudobacillus wudalianchiensis tRNA-Asp
  695. Bacillus xiamenensis tRNA-Asp
  696. Bacillus xiapuensis tRNA-Asp
  697. Bacillus zhangzhouensis tRNA-Asp
  698. bacterium 1XD42-44 tRNA-Asp
  699. bacterium LRH843 tRNA-Asp
  700. Bifidobacterium thermophilum tRNA-Asp
  701. Candidatus Avamphibacillus intestinigallinarum (gut metagenome) tRNA-Asp
  702. Cerasibacillus quisquiliarum tRNA-Asp
  703. Cerasibacillus terrae tRNA-Asp
  704. Cerasibacillus sp. tRNA-Asp
  705. Clostridium sp. 1xD42-85 tRNA-Asp
  706. Compostibacillus humi tRNA-Asp
  707. Cutibacterium acnes tRNA-Asp
  708. Cytobacillus citreus tRNA-Asp
  709. Cytobacillus eiseniae tRNA-Asp
  710. Cytobacillus firmus tRNA-Asp
  711. Cytobacillus gottheilii tRNA-Asp
  712. Cytobacillus horneckiae tRNA-Asp
  713. Cytobacillus kochii tRNA-Asp
  714. Cytobacillus oceanisediminis tRNA-Asp(gtc)
  715. Cytobacillus praedii tRNA-Asp
  716. Cytobacillus pseudoceanisediminis tRNA-Asp
  717. Cytobacillus purgationiresistens tRNA-Asp
  718. Cytobacillus solani tRNA-Asp
  719. Cytobacillus mangrovibacter Cytobacillus sp. FJAT-53684 tRNA-Asp
  720. Cytobacillus sp. FSL H8-0458 tRNA-Asp
  721. Cytobacillus sp. FSL K6-0129 tRNA-Asp
  722. Cytobacillus sp. FSL K6-0265 tRNA-Asp
  723. Cytobacillus sp. FSL M8-0252 tRNA-Asp
  724. Cytobacillus sp. FSL R5-0377 tRNA-Asp
  725. Cytobacillus sp. FSL R5-0569 tRNA-Asp
  726. Cytobacillus sp. FSL R5-0596 tRNA-Asp
  727. Cytobacillus sp. FSL R7-0680 tRNA-Asp
  728. Cytobacillus sp. FSL R7-0696 tRNA-Asp
  729. Cytobacillus sp. FSL W7-1323 tRNA-Asp
  730. Cytobacillus sp. FSL W8-0315 tRNA-Asp
  731. Cytobacillus sp. Hz8 tRNA-Asp
  732. Cytobacillus sp. NJ13 tRNA-Asp
  733. Cytobacillus spongiae tRNA-Asp
  734. Cytobacillus sp. OWB-43 tRNA-Asp
  735. Cytobacillus stercorigallinarum tRNA-Asp
  736. Domibacillus aminovorans tRNA-Asp
  737. Domibacillus antri tRNA-Asp
  738. Domibacillus enclensis tRNA-Asp
  739. Domibacillus epiphyticus tRNA-Asp
  740. Domibacillus iocasae tRNA-Asp
  741. Domibacillus mangrovi tRNA-Asp
  742. Domibacillus sp. 8LH tRNA-Asp
  743. Domibacillus sp. DTU_2020_1001157_1_SI_ALB_TIR_016 tRNA-Asp
  744. Domibacillus tundrae tRNA-Asp
  745. Embleya sp. NPDC056575 tRNA-Asp
  746. Embleya sp. NPDC059237 tRNA-Asp
  747. Escherichia coli tRNA-Asp
  748. Falsibacillus albus tRNA-Asp
  749. Filobacillus milosensis tRNA-Asp
  750. Gracilibacillus dipsosauri tRNA-Asp
  751. Gracilibacillus halophilus YIM-C55.5 tRNA-Asp
  752. Gracilibacillus halotolerans tRNA-Asp
  753. Gracilibacillus marinus tRNA-Asp
  754. Gracilibacillus orientalis tRNA_Asp_GTC
  755. Gracilibacillus pellucidus Gracilibacillus sp. S3-1-1 tRNA-Asp
  756. Gracilibacillus salitolerans tRNA-Asp
  757. Gracilibacillus salinarum tRNA-Asp
  758. Gracilibacillus caseinilyticus tRNA-Asp
  759. Gracilibacillus oryzae tRNA-Asp
  760. Gracilibacillus thailandensis tRNA-Asp
  761. Gracilibacillus ureilyticus tRNA_Asp_GTC
  762. Gracilibacillus xinjiangensis tRNA-Asp
  763. Halalkalibacillus sediminis tRNA-Asp
  764. Halalkalibacter alkaliphilus tRNA-Asp
  765. Halalkalibacter alkalisediminis tRNA-Asp
  766. Halalkalibacterium halodurans C-125 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  767. Halalkalibacterium halodurans tRNA-Asp
  768. Halalkalibacter kiskunsagensis tRNA-Asp
  769. Halalkalibacter oceani tRNA-Asp
  770. Halalkalibacter sp. AB-rgal2 tRNA-Asp
  771. Halobacillus andaensis tRNA-Asp
  772. Halobacillus campisalis tRNA-Asp
  773. Halobacillus dabanensis tRNA_Asp_GTC
  774. Halobacillus faecis tRNA-Asp
  775. Halobacillus halophilus DSM 2266 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 4)
  776. Halobacillus halophilus tRNA-Asp
  777. Halobacillus karajensis tRNA-Asp
  778. Halobacillus kuroshimensis tRNA-Asp
  779. Halobacillus litoralis tRNA-Asp
  780. Halobacillus locisalis tRNA-Asp
  781. Halobacillus mangrovi tRNA-Asp
  782. Halobacillus naozhouensis tRNA-Asp
  783. Halobacillus salinus tRNA-Asp
  784. Halobacillus seohaensis tRNA-Asp
  785. Halobacillus sp. A5 tRNA-Asp
  786. Halobacillus sp. ACCC02827 tRNA-Asp
  787. Halobacillus sp. BBL2006 tRNA-Asp
  788. Halobacillus sp. GSS1 tRNA-Asp
  789. Halobacillus sp. HZG1 tRNA-Asp
  790. Halobacillus yeomjeoni tRNA-Asp
  791. Halobacillus sp. MO56 tRNA-Asp
  792. Halobacillus fulvus tRNA-Asp
  793. Halobacillus salinarum tRNA-Asp
  794. Halobacillus amylolyticus tRNA-Asp
  795. Halobacillus shinanisalinarum tRNA-Asp
  796. Halobacillus sp. SY10 tRNA-Asp
  797. Halobacillus trueperi tRNA-Asp
  798. Halobacillus yeomjeoni tRNA-Asp
  799. Halolactibacillus alkaliphilus tRNA_Asp_GTC
  800. Halolactibacillus halophilus tRNA-Asp
  801. Halolactibacillus miurensis tRNA-Asp
  802. Halomonas sp. MG34 tRNA-Asp
  803. Heyndrickxia oleronia tRNA-Asp
  804. Heyndrickxia sp. FSL K6-6286 tRNA-Asp
  805. Heyndrickxia sp. FSL W8-0496 tRNA-Asp
  806. Heyndrickxia sporothermodurans tRNA-Asp
  807. Kitasatospora purpeofusca tRNA-Asp
  808. Kitasatospora sp. NPDC056181 tRNA-Asp
  809. Kitasatospora sp. NPDC057595 tRNA-Asp
  810. Kitasatospora sp. NPDC057692 tRNA-Asp
  811. Kitasatospora sp. NPDC058218 tRNA-Asp
  812. Klebsiella pneumoniae tRNA-Asp
  813. Lederbergia citri tRNA-Asp
  814. Lederbergia galactosidilytica tRNA-Asp
  815. Lederbergia graminis tRNA-Asp
  816. Lederbergia ruris tRNA-Asp
  817. Lederbergia sp. NSJ-179 tRNA-Asp
  818. Lentibacillus amyloliquefaciens tRNA-Asp
  819. Lentibacillus halodurans tRNA_Asp_GTC
  820. Lentibacillus halophilus tRNA-Asp
  821. Lentibacillus juripiscarius tRNA-Asp
  822. Lentibacillus salicampi tRNA-Asp
  823. Lentibacillus salinarum tRNA-Asp
  824. Lentibacillus sp. CBA3610 tRNA-Asp
  825. Lentibacillus sp. JNUCC-1 tRNA-Asp
  826. Lentibacillus cibarius tRNA-Asp
  827. Lentibacillus cibarius tRNA-Asp
  828. Lentibacillus lipolyticus tRNA-Asp
  829. Lentibacillus sp. tRNA-Asp
  830. Lysinibacillus sphaericus tRNA-Asp
  831. Mangrovibacillus sp. Mu-81 tRNA-Asp
  832. Membranihabitans marinus tRNA-Asp
  833. Mesobacillus foraminis tRNA-Asp
  834. Mesobacillus maritimus tRNA-Asp
  835. Metabacillus bambusae tRNA-Asp
  836. Metabacillus endolithicus tRNA-Asp
  837. Metabacillus halosaccharovorans tRNA-Asp
  838. Metabacillus herbersteinensis tRNA-Asp
  839. Metabacillus litoralis tRNA-Asp
  840. Metabacillus malikii tRNA-Asp
  841. Metabacillus mangrovi tRNA-Asp
  842. Metabacillus niabensis tRNA-Asp
  843. Metabacillus rhizolycopersici tRNA-Asp
  844. Metabacillus sp. B2-18 tRNA-Asp
  845. Metabacillus sediminis Metabacillus sp. FJAT-52054 tRNA-Asp
  846. Metabacillus rhizosphaerae Metabacillus sp. FJAT-53654 tRNA-Asp
  847. Metabacillus flavus tRNA-Asp
  848. Metabacillus elymi tRNA-Asp
  849. Metabacillus sp. tRNA-Asp
  850. Micromonospora profundi tRNA-Asp
  851. Micromonospora sp. 1209 tRNA-Asp
  852. Mycobacteroides abscessus subsp. abscessus tRNA-Asp(gtc)
  853. Mycobacteroides abscessus subsp. massiliense tRNA-Asp(gtc)
  854. Natronobacillus azotifigens tRNA-Asp
  855. Negativibacillus sp. 1xD8-3 tRNA-Asp
  856. Neobacillus cucumis tRNA-Asp
  857. Neobacillus drentensis tRNA-Asp
  858. Neobacillus driksii tRNA-Asp
  859. Neobacillus ginsengisoli tRNA-Asp
  860. Neobacillus niacini tRNA-Asp
  861. Neobacillus novalis tRNA-Asp
  862. Neobacillus pocheonensis tRNA-Asp
  863. Neobacillus driksii Neobacillus sp. 179-J 1A1 HS tRNA-Asp
  864. Neobacillus sp. 211 tRNA-Asp
  865. Neobacillus sp. 3P2-tot-E-2 tRNA-Asp
  866. Neobacillus sp. BF23-41 tRNA-Asp
  867. Neobacillus sp. CF12 tRNA-Asp
  868. Neobacillus sp. DY30 tRNA-Asp
  869. Neobacillus sp. FSL H8-0543 tRNA-Asp
  870. Neobacillus sp. GCM10027624 tRNA-Asp
  871. Neobacillus rhizosphaerae tRNA-Asp
  872. Neobacillus sp. KR4-4 tRNA-Asp
  873. Neobacillus sp. MM2021_6 tRNA-Asp
  874. Neobacillus sp. NPDC058068 tRNA-Asp
  875. Neobacillus sp. NPDC093127 tRNA-Asp
  876. Neobacillus sp. NPDC093182 tRNA-Asp
  877. Neobacillus sp. NPDC097160 tRNA-Asp
  878. Neobacillus sp. OS1-2 tRNA-Asp
  879. Neobacillus sp. OS1-33 tRNA-Asp
  880. Neobacillus sp. PS2-9 tRNA-Asp
  881. Neobacillus sp. PS3-40 tRNA-Asp
  882. Neobacillus oceani Neobacillus sp. SCS-31 tRNA-Asp
  883. Neobacillus sp. SuZ13 tRNA-Asp
  884. Neobacillus sp. tRNA-Asp
  885. Neobacillus sp. WH10 tRNA-Asp
  886. Neobacillus sp. YX16 tRNA-Asp
  887. Neobacillus vireti tRNA-Asp
  888. Niallia hominis tRNA-Asp
  889. Niallia oryzisoli tRNA-Asp
  890. Niallia sp. BSM11 tRNA-Asp
  891. Niallia sp. FSL K6-0077 tRNA-Asp
  892. Niallia sp. FSL K6-0212 tRNA-Asp
  893. Niallia sp. FSL M8-0099 tRNA-Asp
  894. Niallia sp. FSL R7-0271 tRNA-Asp
  895. Niallia sp. FSL R7-0648 tRNA-Asp
  896. Niallia sp. FSL W8-0177 tRNA-Asp
  897. Niallia sp. FSL W8-0635 tRNA-Asp
  898. Niallia sp. FSL W8-0951 tRNA-Asp
  899. Niallia sp. FSL W8-0954 tRNA-Asp
  900. Niallia sp. FSL W8-1348 tRNA-Asp
  901. Niallia tiangongensis Niallia sp. JL1B1071 tRNA-Asp
  902. Niallia sp. Man26 tRNA-Asp
  903. Niallia sp. NCCP-28 tRNA-Asp
  904. Niallia sp. RD1 tRNA-Asp
  905. Niallia sp. SS-2023 tRNA-Asp
  906. Niallia sp. tRNA-Asp
  907. Niallia sp. XMNu-256 tRNA-Asp
  908. Niallia taxi tRNA-Asp
  909. Nocardiopsis dassonvillei tRNA-Asp
  910. Oceanobacillus aidingensis tRNA-Asp
  911. Oceanobacillus arenosus tRNA-Asp
  912. Oceanobacillus bengalensis tRNA-Asp
  913. Oceanobacillus caeni tRNA-Asp
  914. Oceanobacillus chungangensis tRNA-Asp
  915. Oceanobacillus halophilus tRNA-Asp
  916. Oceanobacillus iheyensis HTE831 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  917. Oceanobacillus iheyensis tRNA-Asp
  918. Oceanobacillus indicireducens tRNA-Asp
  919. Oceanobacillus jeddahense tRNA-Asp
  920. Oceanobacillus jordanicus tRNA-Asp
  921. Oceanobacillus kapialis tRNA-Asp
  922. Oceanobacillus kimchii tRNA-Asp
  923. Oceanobacillus locisalsi tRNA-Asp
  924. Oceanobacillus longus tRNA-Asp
  925. Oceanobacillus luteolus tRNA-Asp
  926. Oceanobacillus neutriphilus tRNA-Asp
  927. Oceanobacillus oncorhynchi subsp. incaldanensis tRNA-Asp
  928. Oceanobacillus oncorhynchi subsp. oncorhynchi tRNA-Asp
  929. Oceanobacillus oncorhynchi tRNA-Asp
  930. Oceanobacillus picturae tRNA-Asp
  931. Oceanobacillus polygoni tRNA-Asp
  932. Oceanobacillus profundus tRNA-Asp
  933. Oceanobacillus sojae tRNA-Asp
  934. Oceanobacillus sp. 143 tRNA-Asp
  935. Oceanobacillus zhaokaii tRNA-Asp
  936. Oceanobacillus sp. 1P07AA tRNA-Asp
  937. Oceanobacillus sp. E9 tRNA-Asp
  938. Oceanobacillus sp. FSL H7-0719 tRNA-Asp
  939. Oceanobacillus sp. FSL K6-0118 tRNA-Asp
  940. Oceanobacillus sp. FSL K6-0127 tRNA-Asp
  941. Oceanobacillus sp. FSL K6-0251 tRNA-Asp
  942. Oceanobacillus sp. FSL K6-2867 tRNA-Asp
  943. Oceanobacillus sp. FSL K6-3682 tRNA-Asp
  944. Oceanobacillus sp. FSL W7-1281 tRNA-Asp
  945. Oceanobacillus sp. FSL W7-1293 tRNA-Asp
  946. Oceanobacillus sp. FSL W7-1304 tRNA-Asp
  947. Oceanobacillus sp. FSL W7-1309 tRNA-Asp
  948. Oceanobacillus sp. FSL W8-0428 tRNA-Asp
  949. Oceanobacillus sp. HCA-5259 tRNA-Asp
  950. Oceanobacillus sp. ISL-73 tRNA-Asp
  951. Oceanobacillus sp. ISL-74 tRNA-Asp
  952. Oceanobacillus sp. J11TS1 tRNA-Asp
  953. Oceanobacillus sp. MO10714A tRNA-Asp
  954. Oceanobacillus sp. SE10311 tRNA-Asp
  955. Oceanobacillus piezotolerans tRNA-Asp
  956. Ornithinibacillus bavariensis tRNA-Asp
  957. Ornithinibacillus caprae tRNA-Asp
  958. Ornithinibacillus halotolerans tRNA-Asp
  959. Ornithinibacillus hominis tRNA-Asp
  960. Ornithinibacillus massiliensis tRNA-Asp
  961. Ornithinibacillus salinisoli tRNA-Asp
  962. Ornithinibacillus xuwenensis Ornithinibacillus sp. 16A2E tRNA-Asp
  963. Ornithinibacillus sp. 179-J 7C1 HS tRNA-Asp
  964. Ornithinibacillus sp. FSL M8-0202 tRNA-Asp
  965. Ornithinibacillus sp. JPR2-1 tRNA-Asp
  966. Ornithinibacillus sp. tRNA-Asp
  967. Paenibacillus sp. 7884-2 tRNA-Asp
  968. Paenibacillus sp. FSL R5-0490 tRNA-Asp
  969. Pallidibacillus pasinlerensis tRNA-Asp
  970. Pallidibacillus thermolactis subsp. kokeshiiformis tRNA-Asp
  971. Pallidibacillus thermolactis tRNA-Asp
  972. Paracoccus sp. DMF tRNA-Asp
  973. Paraliobacillus quinghaiensis tRNA-Asp
  974. Paraliobacillus ryukyuensis tRNA-Asp
  975. Paraliobacillus sp. JSM ZJ581 tRNA-Asp
  976. Paraliobacillus sp. PM-2 tRNA-Asp
  977. Peribacillus asahii tRNA-Asp
  978. Peribacillus cavernae tRNA-Asp
  979. Peribacillus huizhouensis tRNA-Asp
  980. Peribacillus psychrosaccharolyticus tRNA-Asp
  981. Peribacillus sp. FSL H8-0477 tRNA-Asp
  982. Peribacillus sp. Hz7 tRNA-Asp
  983. Peribacillus sp. NPDC096379 tRNA-Asp
  984. Perspicuibacillus lycopersici tRNA-Asp
  985. Piscibacillus salipiscarius tRNA-Asp
  986. Planococcus maritimus tRNA-Asp
  987. Planococcus sp. SIMBA_143 tRNA-Asp
  988. Pontibacillus chungwhensis BH030062 tRNA-Asp
  989. Pontibacillus chungwhensis tRNA-Asp
  990. Pontibacillus halophilus JSM 076056 = DSM 19796 tRNA-Asp
  991. Pontibacillus litoralis JSM 072002 tRNA-Asp
  992. Pontibacillus marinus BH030004 = DSM 16465 tRNA-Asp
  993. Pontibacillus salicampi tRNA-Asp
  994. Pontibacillus salipaludis tRNA-Asp
  995. Pontibacillus sp. ALD_SL1 tRNA-Asp
  996. Pontibacillus sp. HMF3514 tRNA-Asp
  997. Pontibacillus yanchengensis tRNA-Asp
  998. Pontibacillus yanchengensis Y32 tRNA-Asp
  999. Pradoshia sp. D12 tRNA-Asp
  1000. Priestia sp. WB3 tRNA-Asp
  1001. Pseudobacillus sp. 179-B 2D1 NHS tRNA-Asp
  1002. Pseudobacillus sp. FSL P4-0506 tRNA-Asp
  1003. Pseudobacillus sp. tRNA-Asp
  1004. Bacillus subtilis A29 tRNA-Asp
  1005. Pseudomonas sp. ISL-84 tRNA-Asp
  1006. Pseudomonas sp. ISL-88 tRNA-Asp
  1007. Pseudoneobacillus rhizosphaerae tRNA-Asp
  1008. Pseudoneobacillus sp. tRNA-Asp
  1009. Radiobacillus kanasensis tRNA-Asp
  1010. Ralstonia pickettii tRNA-Asp
  1011. Rhizobium ruizarguesonis tRNA-Asp
  1012. Rhodococcus qingshengii tRNA-Asp
  1013. Rhodococcus zopfii tRNA-Asp
  1014. Anoxybacillus andreesenii tRNA-Asp
  1015. Robertmurraya crescens tRNA-Asp
  1016. Robertmurraya siralis tRNA-Asp
  1017. Robertmurraya sp. 2P01SA tRNA-Asp
  1018. Robertmurraya sp. FSL W8-0741 tRNA-Asp
  1019. Roseburia sp. 1XD42-34 tRNA-Asp
  1020. Rossellomorea aquimaris tRNA-Asp
  1021. Rossellomorea oryzaecorticis tRNA-Asp
  1022. Rossellomorea sp. AcN35-11 tRNA-Asp
  1023. Rossellomorea sp. DA94 tRNA-Asp
  1024. Rossellomorea sp. GCM10028870 tRNA-Asp
  1025. Rossellomorea sp. KS-H15a tRNA-Asp
  1026. Rossellomorea sp. LJF3 tRNA-Asp
  1027. Rossellomorea sp. NPDC077527 tRNA-Asp
  1028. Rossellomorea sp. y25 tRNA-Asp
  1029. Rossellomorea yichunensis tRNA-Asp
  1030. Rossellomorea sp. YZS02 tRNA-Asp
  1031. Salimicrobium album tRNA_Asp_GTC
  1032. Salimicrobium halophilum tRNA_Asp_GTC
  1033. Salimicrobium jeotgali tRNA-Asp
  1034. Salimicrobium sp. PL1-032A tRNA-Asp
  1035. Salimicrobium humidisoli tRNA-Asp
  1036. Salinibacillus xinjiangensis tRNA-Asp
  1037. Salirhabdus euzebyi tRNA-Asp
  1038. Sediminibacillus dalangtanensis tRNA-Asp
  1039. Shouchella clausii KSM-K16 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1040. Shouchella clausii tRNA-Asp
  1041. Shouchella hunanensis tRNA-Asp
  1042. Shouchella lehensis G1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1043. Shouchella miscanthi tRNA-Asp
  1044. Shouchella rhizosphaerae tRNA-Asp
  1045. Shouchella sp. 1P01AA tRNA-Asp
  1046. Shouchella sp. 1P09AA tRNA-Asp
  1047. Shouchella sp. JSM 1781072 tRNA-Asp
  1048. Shouchella xiaoxiensis tRNA-Asp
  1049. Sinobaca qinghaiensis tRNA-Asp
  1050. Bacillus velezensis A3 tRNA-Asp
  1051. Sporosarcina globispora tRNA-Asp
  1052. Streptococcus pneumoniae tRNA-Asp(gtc)
  1053. Streptomyces albidoflavus tRNA-Asp
  1054. Streptomyces chartreusis tRNA-Asp
  1055. Streptomyces cyaneofuscatus tRNA-Asp
  1056. Streptomyces erythrochromogenes tRNA-Asp
  1057. Streptomyces eurythermus tRNA-Asp
  1058. Streptomyces griseus Streptomyces fimicarius tRNA-Asp
  1059. Streptomyces fungicidicus tRNA-Asp
  1060. Streptomyces massasporeus tRNA-Asp
  1061. Streptomyces mirabilis tRNA-Asp
  1062. Streptomyces olivaceus tRNA-Asp
  1063. Streptomyces rubiginosohelvolus tRNA-Asp
  1064. Streptomyces scopuliridis tRNA-Asp
  1065. Streptomyces sp. NPDC055961 tRNA-Asp
  1066. Streptomyces sp. NPDC056441 tRNA-Asp
  1067. Streptomyces sp. NPDC056465 tRNA-Asp
  1068. Streptomyces sp. NPDC056470 tRNA-Asp
  1069. Streptomyces sp. NPDC056544 tRNA-Asp
  1070. Streptomyces sp. NPDC056637 tRNA-Asp
  1071. Streptomyces sp. NPDC056701 tRNA-Asp
  1072. Streptomyces sp. NPDC056708 tRNA-Asp
  1073. Streptomyces sp. NPDC056716 tRNA-Asp
  1074. Streptomyces sp. NPDC056734 tRNA-Asp
  1075. Streptomyces sp. NPDC056756 tRNA-Asp
  1076. Streptomyces sp. NPDC056820 tRNA-Asp
  1077. Streptomyces sp. NPDC056821 tRNA-Asp
  1078. Streptomyces sp. NPDC056831 tRNA-Asp
  1079. Streptomyces sp. NPDC056883 tRNA-Asp
  1080. Streptomyces sp. NPDC056910 tRNA-Asp
  1081. Streptomyces sp. NPDC057011 tRNA-Asp
  1082. Streptomyces sp. NPDC057592 tRNA-Asp
  1083. Streptomyces sp. NPDC057651 tRNA-Asp
  1084. Streptomyces sp. NPDC057680 tRNA-Asp
  1085. Streptomyces sp. NPDC057695 tRNA-Asp
  1086. Streptomyces sp. NPDC057696 tRNA-Asp
  1087. Streptomyces sp. NPDC057697 tRNA-Asp
  1088. Streptomyces sp. NPDC057740 tRNA-Asp
  1089. Streptomyces sp. NPDC057748 tRNA-Asp
  1090. Streptomyces sp. NPDC057888 tRNA-Asp
  1091. Streptomyces sp. NPDC058051 tRNA-Asp
  1092. Streptomyces sp. NPDC059919 tRNA-Asp
  1093. Streptomyces sp. NPDC059990 tRNA-Asp
  1094. Streptomyces wedmorensis tRNA-Asp
  1095. Tenuibacillus multivorans tRNA-Asp
  1096. Terribacillus aidingensis tRNA-Asp
  1097. Terribacillus saccharophilus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1098. Terribacillus halophilus tRNA-Asp
  1099. Terribacillus saccharophilus tRNA_Asp_GTC
  1100. Terribacillus sp. 179-K 1B1 HS tRNA-Asp
  1101. Terribacillus sp. FSL K6-0262 tRNA-Asp
  1102. Terribacillus sp. JSM ZJ617 tRNA-Asp
  1103. Terrihalobacillus insolitus tRNA-Asp
  1104. Thalassobacillus devorans tRNA-Asp
  1105. Thalassobacillus hwangdonensis tRNA-Asp
  1106. Thalassobacillus sp. FIB228 tRNA-Asp
  1107. Thermoproteota archaeon tRNA-Asp
  1108. Ureibacillus sp. tRNA-Asp
  1109. Vibrio cholerae tRNA-Asp
  1110. Virgibacillus alimentarius tRNA-Asp
  1111. Virgibacillus byunsanensis tRNA-Asp
  1112. Virgibacillus dokdonensis tRNA-Asp
  1113. Virgibacillus halodenitrificans tRNA-Asp
  1114. Tigheibacillus halophilus Virgibacillus halophilus tRNA-Asp
  1115. Virgibacillus indicus tRNA-Asp
  1116. Virgibacillus kapii tRNA-Asp
  1117. Virgibacillus kekensis tRNA-Asp
  1118. Virgibacillus litoralis tRNA-Asp
  1119. Virgibacillus massiliensis tRNA-Asp
  1120. Virgibacillus natechei tRNA-Asp
  1121. Virgibacillus necropolis tRNA-Asp
  1122. Virgibacillus oceani tRNA-Asp
  1123. Virgibacillus pantothenticus tRNA-Asp
  1124. Virgibacillus phasianinus tRNA-Asp
  1125. Virgibacillus profundi tRNA-Asp
  1126. Virgibacillus proomii tRNA-Asp
  1127. Virgibacillus salarius tRNA-Asp
  1128. Virgibacillus sediminis tRNA-Asp
  1129. Paracerasibacillus soli tRNA-Asp
  1130. Virgibacillus sp. 19R1-5 tRNA-Asp
  1131. Virgibacillus sp. 6R tRNA-Asp
  1132. Virgibacillus sp. 7505 tRNA-Asp
  1133. Virgibacillus sp. AGTR tRNA-Asp
  1134. Virgibacillus tibetensis Virgibacillus sp. C22-A2 tRNA-Asp
  1135. Virgibacillus sp. CBA3643 tRNA-Asp
  1136. Virgibacillus sp. CM-4 tRNA-Asp
  1137. Virgibacillus sp. tRNA-Asp
  1138. Virgibacillus sp. JSM 102003 tRNA-Asp
  1139. Virgibacillus sp. M23 tRNA-Asp
  1140. Virgibacillus salidurans Virgibacillus sp. NKC19-16 tRNA-Asp
  1141. Virgibacillus saliphilus tRNA-Asp
  1142. Virgibacillus sp. SK37 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 3)
  1143. Virgibacillus xinjiangensis tRNA-Asp
  1144. Viridibacillus arenosi FSL R5-213 tRNA-Asp
  1145. Viridibacillus arenosi tRNA-Asp
  1146. Viridibacillus arvi tRNA-Asp
  1147. Viridibacillus sp. FSL E2-0187 tRNA-Asp
  1148. Viridibacillus sp. FSL H7-0596 tRNA-Asp
  1149. Viridibacillus sp. FSL H8-0110 tRNA-Asp
  1150. Viridibacillus sp. FSL H8-0123 tRNA-Asp
  1151. Viridibacillus sp. FSL R5-0468 tRNA-Asp
  1152. Viridibacillus sp. FSL R5-0477 tRNA-Asp
  1153. Viridibacillus sp. FSL R5-0888 tRNA-Asp
  1154. Viridibacillus arvi tRNA-Asp
  1155. Viridibacillus soli tRNA-Asp
  1156. Xanthomonas citri pv. citri tRNA-Asp
  1157. Yersinia enterocolitica tRNA-Asp
Relationships

Molecular Relationships

2D structure

Loading 2D structure...