Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-214-3p URS00002C11C3_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (miRBase, TarBase, PSICQUIC, LncBase, MirGeneDB, RefSeq, ENA, IntAct, GeneCards, MalaCards). Described in 74 papers. Homo sapiens (human) hsa-miR-214-3p sequence is a product of MIR214, miR-214, hsa-miR-214, miR-214-3p, hsa-miR-214-3p, MIR199A2/214 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 16E1BP, 17b-HSD10, 3'HEXO, 3-10C, 4-1BB, 6.8PL, A1, A170, A1A.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-214-3p interacts with:

Interaction id Participant Synonyms
EBI-22304177 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-24811346 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-22275553 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22274067 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-25297104 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
URS00002C11C3_9606-7 P17861 P17861
URS00002C11C3_9606-0 P17861 P17861
URS00002C11C3_9606-1 P29536 P29536
URS00002C11C3_9606-8 P29536 P29536
URS00002C11C3_9606-2 P29972 P29972
URS00002C11C3_9606-9 P60484 P60484
URS00002C11C3_9606-3 P60484 P60484
URS00002C11C3_9606-4 Q03181 Q03181
URS00002C11C3_9606-10 Q03181 Q03181
URS00002C11C3_9606-5 Q06413 Q06413
URS00002C11C3_9606-11 Q06413 Q06413
URS00002C11C3_9606-6 Q9UIK4 Q9UIK4
URS00002C11C3_9606-12 Q9UIK4 Q9UIK4

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGCAGGCACAGACAGGCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 49 other species

    1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
    2. Anolis carolinensis aca-miR-214-3p
    3. Artibeus jamaicensis aja-miR-214
    4. Bos taurus (cattle) bta-miR-214
    5. Callithrix jacchus cja-miR-214
    6. Canis lupus familiaris cfa-miR-214
    7. Cavia porcellus (domestic guinea pig) cpo-miR-214-3p
    8. Cervus elaphus (red deer) cel-miR-214
    9. Chrysemys picta bellii Cpi-Mir-214-v1_3p (mature (guide))
    10. Columba livia (rock pigeon) cli-miR-214-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-3p
    12. Daubentonia madagascariensis (aye-aye) dma-miR-214
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
    14. Equus caballus (horse) eca-miR-214
    15. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
    16. Macaca mulatta Mml-Mir-214-v1_3p (mature (guide))
    17. Microcebus murinus mmr-miR-214
    18. Monodelphis domestica Mdo-Mir-214-v1_3p (mature (guide))
    19. Mus musculus (house mouse) mmu-miR-214-3p
    20. Nomascus leucogenys nle-miR-214
    21. Ornithorhynchus anatinus oan-miR-214-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-214-3p
    23. Otolemur garnettii oga-miR-214
    24. Papio hamadryas (hamadryas baboon) pha-miR-214
    25. Pteropus alecto pal-miR-214-3p
    26. Python bivittatus pbv-miR-214-3p
    27. Rattus norvegicus Rno-Mir-214-v1_3p (mature (guide))
    28. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
    30. Taeniopygia guttata (zebra finch) tgu-miR-214-3p
    31. Tursiops truncatus miR-214
    32. Xenopus tropicalis Xtr-Mir-214-v1_3p (mature (guide))