v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-20b-5p URS00002B3783_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-20b: Gga-mir-20b is a microRNA that is regulated by FOXO3, a major regulator of oxidative stress and metabolic pathways, and its expression is significantly higher in delay-fed birds [PMC7936154]. The expression of gga-mir-20b in the liver is downregulated after hatching and is significantly lower in fed-from-hatch chicks compared to delayed-fed chicks [PMC7936154]. Gga-mir-20b has been found to target lipid metabolism-associated genes such as MSMO1 and FADS1 [PMC7936154]. The upstream region of gga-mir-20b was obtained from Ensembl, and promoter-like elements were predicted using PROSCAN [PMC5583987]. A bait strain containing the gga-mir-20b promoter cassette was generated following the manufacturer's instructions [PMC5583987].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAAGUGCUCAUAGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-17-P4c_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-17-P4c_5p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-20b
  4. Callorhinchus milii Cmi-Mir-17-P4c_5p (mature (guide))
  5. Capra hircus miR-20b
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P4c_5p (mature (guide))
  7. Columba livia (rock pigeon) cli-miR-20b-5p
  8. Cricetulus griseus (Chinese hamster) cgr-miR-20b
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-20b-5p
  10. Echinops telfairi Ete-Mir-17-P4c_5p (mature (guide))
  11. Equus caballus (horse) eca-miR-20b
  12. Gekko japonicus Gja-Mir-17-P4c_5p (mature (guide))
  13. Gorilla gorilla gorilla ggo-miR-20b (MIR20B)
  14. Gorilla gorilla (western gorilla) ggo-miR-20b
  15. Homo sapiens (human) hsa-miR-20b-5p
  16. Macaca mulatta (Rhesus monkey) mml-miR-20b-5p
  17. Monodelphis domestica mdo-miR-20b-5p
  18. Mus musculus (house mouse) mmu-miR-20b-5p
  19. Ornithorhynchus anatinus oan-miR-20b-5p
  20. Oryctolagus cuniculus (rabbit) Ocu-Mir-17-P4c_5p (mature (guide))
  21. Ovis aries miscellaneous RNA
  22. Pan troglodytes ptr-miR-20b
  23. Pongo pygmaeus (Bornean orangutan) ppy-miR-20b
  24. Pteropus alecto pal-miR-20b-5p
  25. Python bivittatus pbv-miR-20b-5p
  26. Rattus norvegicus (Norway rat) rno-miR-20b-5p
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P4c_5p (mature (guide))
  28. Scyliorhinus torazame Sto-Mir-17-P4c_5p (mature (guide))
  29. Sphenodon punctatus (tuatara) Spt-Mir-17-P4c_5p (mature (guide))
  30. Taeniopygia guttata tgu-miR-20b-5p
  31. Xenopus laevis xla-miR-20
  32. Xenopus tropicalis (tropical clawed frog) xtr-miR-20b
 Publications