Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
mmu-mir-20b: Mmu-mir-20b is a member of the miR-17 microRNA precursor family and is expressed in the embryonic hearts of various organisms, including zebrafish, rat, and mouse [PMC4405592]. Bioinformatics analysis has identified Bambi as a potential target gene of mmu-mir-20b [PMC4405592]. The mature sequence of mmu-mir-20b is CAAAGTGCTCATAGTGCAGGTAG [PMC4405592]. In a study using P19 cells, the overexpression and silencing vectors of mmu-mir-20b were transfected to observe GFP expression under a fluorescence microscope [PMC4405592]. A stable P19 mmu-mir-20b overexpression line and a stable miR-20b silenced cell line were constructed for further analysis [PMC4405592]. Additionally, mmu-mir-20b has been identified as one of the miRNAs potentially targeting PXN during the progression of a model [PMC3030602]. In murine retrovirus-induced T-cell lymphomas with retroviral integration within the mir-106a-363 locus, higher expression levels of mmu-mir-20b were observed compared to lymphomas without integration in this locus [PMC7290785]. Furthermore, this locus contains other miRNAs such as mmu-miR-106a, mmu-miR19b-2, and mmu-miR92a. The expression levels of various miRNAs including mmu-miR20a3p, -5p, -106a5p and -mir 20b were assessed in another study using murine cells [PMC7069219]. Finally, to investigate the effect on FGF2 and GRB2 expressions in 661w cells after transfection with mmu mir-20b mimic or inhibitor, mRNA and protein expression levels were detected [PMC6834413].
mRNA interactions
4 total
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset