Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-374a URS000029E173_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-374a: bta-mir-374a, a microRNA, was found to be differentially expressed between lactating and non-lactating cows [PMC6162677]. In the study, bta-mir-374a was identified as the most significantly down-regulated miRNA, along with bta-miR-15b and bta-miR-26a [PMC6162677]. Conversely, bta-miR-455-5p, bta-miR-210, and bta-miR-497 were the most significantly up-regulated miRNAs [PMC6162677]. It was discovered that bta-mir-374a potentially targeted 36 different genes that are important for ileum functions [PMC6162677]. However, in a ddPCR validation study, only the expression of bta-miR-1246 was consistent with the sequencing result [PMC7519046]. Additionally, in another study comparing HS-EVs and control-EVs in cows, five miRNAs were found to be significantly enriched in HS-EVs including bta-mir-374a [PMC7519046]. In a study on bubaline PBMCs infected with M. paratuberculosis, it was observed that most of the miRNAs including bta-mir-374a were downregulated [PMC7242893]. Interestingly, hsa-miR-374a-5p had three bovine homologs including bta-mir-374a [PMC9459146]. Furthermore, hsa-miR 1283 and hsa miR 664b 3p along with their bovine homologs are considered promising candidates for further research [PMC9459146]. References: [PMC6162677] [PMC7519046] [PMC7242893] [PMC9459146]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAUACAACCUGAUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Canis lupus familiaris Cfa-Mir-374-P1_5p (mature (co-guide))
  2. Cavia porcellus cpo-miR-374-5p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-374a-5p
  4. Equus caballus eca-miR-374a
  5. Homo sapiens (human) hsa-miR-374a-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-374a-5p
  7. Oryctolagus cuniculus (rabbit) ocu-miR-374a-5p
  8. Ovis aries (sheep) oar-miR-374a
  9. Pan troglodytes ptr-miR-374a
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-374a
  11. Sus scrofa ssc-miR-374a-5p
  12. Tupaia chinensis tch-miR-374a-5p
Publications