Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-374a-5p URS000029E173_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAUACAACCUGAUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus bta-miR-374a
  2. Canis lupus familiaris Cfa-Mir-374-P1_5p (mature (co-guide))
  3. Cavia porcellus cpo-miR-374-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-374a-5p
  5. Equus caballus eca-miR-374a
  6. Homo sapiens (human) hsa-miR-374a-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-374a-5p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-374a-5p
  9. Ovis aries (sheep) oar-miR-374a
  10. Pan troglodytes ptr-miR-374a
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-374a
  12. Tupaia chinensis tch-miR-374a-5p
Publications