Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-519d-3p URS0000298BA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-519d: Hsa-mir-519d is a microRNA implicated in various cellular processes and has been identified as a potential player in hepatocellular carcinoma (HCC) [PMC7167370]. It is known to bind with the pseudogene RPLP0P2, along with other microRNAs, suggesting a complex regulatory network [PMC7249743]. Although its precise role in HCC remains to be fully elucidated, hsa-mir-519d has been associated with the disease [PMC7167370]. Additionally, hsa-mir-519d is one of the microRNAs found to be downregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal tissues, indicating its potential involvement in pancreatic cancer as well [PMC5649611]. It has also been identified in abdominal tissue, where it is differentially expressed and associated with target mRNAs [PMC3216936]. These findings suggest that hsa-mir-519d may have significant functions in cancer biology and could be an important target for further research into its role in tumorigenesis and potential therapeutic applications.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCCUCCCUUUAGAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-519d (MIR519D)
  2. Gorilla gorilla ggo-miR-519d
  3. Pan troglodytes ptr-miR-519d
  4. Pongo pygmaeus ppy-miR-519d
Relationships New

Molecular Relationships

GoFlow Results Publications